array:23 [
  "pii" => "S0365059623002325"
  "issn" => "03650596"
  "doi" => "10.1016/j.abd.2023.05.003"
  "estado" => "S300"
  "fechaPublicacion" => "2024-03-01"
  "aid" => "851"
  "copyright" => "Sociedade Brasileira de Dermatologia"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "pt" => array:18 [
      "pii" => "S2666275223002813"
      "issn" => "26662752"
      "doi" => "10.1016/j.abdp.2023.11.003"
      "estado" => "S300"
      "fechaPublicacion" => "2024-03-01"
      "aid" => "851"
      "copyright" => "Sociedade Brasileira de Dermatologia"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "pt" => array:12 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Artigo original</span>"
        "titulo" => "N&#237;vel s&#233;rico de adiponectina e polimorfismo do gene <span class="elsevierStyleItalic">ADIPOQ</span> em pacientes eg&#237;pcios com alopecia areata"
        "tienePdf" => "pt"
        "tieneTextoCompleto" => "pt"
        "tieneResumen" => "pt"
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "181"
            "paginaFinal" => "188"
          ]
        ]
        "contieneResumen" => array:1 [
          "pt" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "pt" => true
        ]
        "contienePdf" => array:1 [
          "pt" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0005"
            "etiqueta" => "Figura 1"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr1.jpeg"
                "Alto" => 2429
                "Ancho" => 1675
                "Tamanyo" => 219983
              ]
            ]
            "descripcion" => array:1 [
              "pt" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Gen&#243;tipos do polimorfismo <span class="elsevierStyleItalic">&#40;rs2241766&#41;</span> do gene <span class="elsevierStyleItalic">ADIPOQ</span> em rela&#231;&#227;o a&#58; n&#237;vel s&#233;rico de adiponectina entre os pacientes com AA estudados &#40;A&#41;&#59; escore SALT dos pacientes com AA estudados &#40;B&#41;&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Azza Gaber Antar Farag, Eman Abd&#8208;Elfatah Badr, Banan Mohamed Gamal Abd&#8208;Elaty, Nada Farag Elnaidany, Mai Medhat Mohamed Ghanem"
            "autores" => array:5 [
              0 => array:2 [
                "nombre" => "Azza Gaber Antar"
                "apellidos" => "Farag"
              ]
              1 => array:2 [
                "nombre" => "Eman Abd&#8208;Elfatah"
                "apellidos" => "Badr"
              ]
              2 => array:2 [
                "nombre" => "Banan Mohamed Gamal"
                "apellidos" => "Abd&#8208;Elaty"
              ]
              3 => array:2 [
                "nombre" => "Nada Farag"
                "apellidos" => "Elnaidany"
              ]
              4 => array:2 [
                "nombre" => "Mai Medhat Mohamed"
                "apellidos" => "Ghanem"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "pt"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S0365059623002325"
          "doi" => "10.1016/j.abd.2023.05.003"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623002325?idApp=UINPBA00008Z"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223002813?idApp=UINPBA00008Z"
      "url" => "/26662752/0000009900000002/v2_202407310539/S2666275223002813/v2_202407310539/pt/main.assets"
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S0365059623002465"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2023.01.008"
    "estado" => "S300"
    "fechaPublicacion" => "2024-03-01"
    "aid" => "865"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Associations of serum gamma-linolenic acid levels with erythema severity and anxiety&#47;depression status in patients with rosacea"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "189"
          "paginaFinal" => "195"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1520
              "Ancho" => 2091
              "Tamanyo" => 131293
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0025"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Comparisons of CEA and PSA scores between the low-level GLA group and the high-level GLA group&#46; &#40;A&#41; Comparison of CEA scores&#46; &#40;B&#41; Comparison of PSA scores&#46; &#42;&#42; Indicates p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#59; n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>53 for the low group&#59; n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>9 for the high-level group&#46; The error bars present the SD&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Jin-Yi Tang, Mei-Ling Chen, Mei Wan, Jin-Yu Wei, Tian Qian, Yu-Kun Fan, Zhi Yang, Jian Fu, Jian Li"
          "autores" => array:9 [
            0 => array:2 [
              "nombre" => "Jin-Yi"
              "apellidos" => "Tang"
            ]
            1 => array:2 [
              "nombre" => "Mei-Ling"
              "apellidos" => "Chen"
            ]
            2 => array:2 [
              "nombre" => "Mei"
              "apellidos" => "Wan"
            ]
            3 => array:2 [
              "nombre" => "Jin-Yu"
              "apellidos" => "Wei"
            ]
            4 => array:2 [
              "nombre" => "Tian"
              "apellidos" => "Qian"
            ]
            5 => array:2 [
              "nombre" => "Yu-Kun"
              "apellidos" => "Fan"
            ]
            6 => array:2 [
              "nombre" => "Zhi"
              "apellidos" => "Yang"
            ]
            7 => array:2 [
              "nombre" => "Jian"
              "apellidos" => "Fu"
            ]
            8 => array:2 [
              "nombre" => "Jian"
              "apellidos" => "Li"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275223002941"
        "doi" => "10.1016/j.abdp.2023.11.016"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223002941?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623002465?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009900000002/v2_202407221312/S0365059623002465/v2_202407221312/en/main.assets"
  ]
  "itemAnterior" => array:17 [
    "pii" => "S0365059623002441"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2023.08.004"
    "estado" => "S300"
    "fechaPublicacion" => "2024-03-01"
    "aid" => "863"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Continuing Medical Education</span>"
      "titulo" => "Infections in the era of immunobiologicals"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "167"
          "paginaFinal" => "180"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0015"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 2219
              "Ancho" => 3333
              "Tamanyo" => 447871
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0015"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Conduct in cases of immunobiological use and hepatitis B&#46; Adapted source&#58; Romiti R&#44; et al&#46; 2020&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a></p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Ricardo Romiti, Andr&#233; Lu&#237;s da Silva Hirayama, Adriana Maria Porro, Heitor de S&#225; Gon&#231;alves, Luciane Donida Bartoli Miot, Sandra Maria Barbosa Dur&#227;es, Silvio Alencar Marques"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Ricardo"
              "apellidos" => "Romiti"
            ]
            1 => array:2 [
              "nombre" => "Andr&#233; Lu&#237;s da Silva"
              "apellidos" => "Hirayama"
            ]
            2 => array:2 [
              "nombre" => "Adriana Maria"
              "apellidos" => "Porro"
            ]
            3 => array:2 [
              "nombre" => "Heitor de S&#225;"
              "apellidos" => "Gon&#231;alves"
            ]
            4 => array:2 [
              "nombre" => "Luciane Donida Bartoli"
              "apellidos" => "Miot"
            ]
            5 => array:2 [
              "nombre" => "Sandra Maria Barbosa"
              "apellidos" => "Dur&#227;es"
            ]
            6 => array:2 [
              "nombre" => "Silvio Alencar"
              "apellidos" => "Marques"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275223002928"
        "doi" => "10.1016/j.abdp.2023.11.014"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223002928?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623002441?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009900000002/v2_202407221312/S0365059623002441/v2_202407221312/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Adiponectin serum levels and <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; polymorphism in alopecia areata Egyptian patients"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "181"
        "paginaFinal" => "188"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Azza Gaber Antar Farag, Eman Abd-Elfatah Badr, Banan Mohamed Gamal Abd-Elaty, Nada Farag Elnaidany, Mai Medhat Mohamed Ghanem"
        "autores" => array:5 [
          0 => array:3 [
            "nombre" => "Azza Gaber Antar"
            "apellidos" => "Farag"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Eman Abd-Elfatah"
            "apellidos" => "Badr"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Banan Mohamed Gamal"
            "apellidos" => "Abd-Elaty"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Nada Farag"
            "apellidos" => "Elnaidany"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          4 => array:4 [
            "nombre" => "Mai Medhat Mohamed"
            "apellidos" => "Ghanem"
            "email" => array:1 [
              0 => "mai_medhat251@yahoo.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "&#42;"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Dermatology&#44; Andrology and STDs Department&#44; Faculty of Medicine&#44; Menoufia University&#44; Shebin El-Kom&#44; Menoufia&#44; Egypt"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Medical Biochemistry and Molecular Biology Department&#44; Faculty of Medicine&#44; Menoufia University&#44; Shebin El-Kom&#44; Menoufia&#44; Egypt"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Dermatology Department&#44; Sers El-Lian General Hospital&#44; Ministry of Health&#44; Sers El-Lian&#44; Menoufia&#44; Egypt"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Clinical Pharmacy department&#44; Faculty of Pharmacy&#44; Modern Sciences and Arts University&#44; 6TH October&#44; Egypt"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2429
            "Ancho" => 1675
            "Tamanyo" => 226700
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; genotypes in relation to&#58; &#40;A&#41; Serum adiponectin levels among the studied AA patients&#46; &#40;B&#41; SALT score of studied AA patients&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Alopecia areata represents a type of hair loss&#44; in which the immune system mistakenly attacks hair follicles&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> The estimated prevalence of AA is approximately 1 in 1000 people&#44; with a lifespan risk of about 2&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> Both adults and children are affected by AA&#44; with a similar rate in females and males&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">The exact etiology of AA remains elusive&#46; It is considered an autoimmune disorder&#46; The immune system in its entirety is influenced by many genetic and multiple environmental factors&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> AA is associated with an increased risk of metabolic comorbidities&#44; suggesting that adipokines may play a role in AA pathogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">Adipose tissue is not an inert tissue&#46; It actively produces adipokines&#46; These adipokines&#44; in addition to regulation of energy expenditure and insulin sensitivity&#44; play an important role as regulators of many physiologic and pathologic processes&#44; comprising inflammation and immunity&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Adiponectin is an adipose tissue circulating adipokine that enhances insulin sensitivity&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> It is a protein having 224 amino acids&#46; Adiponectin structure is made of a single-chain of trimmers&#59; a variable N-terminal domain&#44; a C-terminal globular domain&#44; and a collagen domain&#46; This trimer is enclosed by a bell-shaped structure&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">Adiponectin exerts many pleiotropic actions&#59; it promotes insulin sensitivity&#44; promotes apoptosis in carcinogenic cells&#44; and has antioxidant and anti-inflammatory effects&#46;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a></p><p id="par0030" class="elsevierStylePara elsevierViewall">A decreased blood level of adiponectin has been found in psoriasis&#44;<a class="elsevierStyleCrossRefs" href="#bib0050"><span class="elsevierStyleSup">10&#44;11</span></a> acne vulgaris&#44;<a class="elsevierStyleCrossRefs" href="#bib0060"><span class="elsevierStyleSup">12&#8211;14</span></a> and atopic dermatitis&#46;<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> However&#44; in AA only two recent studies were interested in investigating adiponectin serum levels in AA patients&#46; Moreover&#44; the two author groups reported controversial results&#46;<a class="elsevierStyleCrossRefs" href="#bib0080"><span class="elsevierStyleSup">16&#44;17</span></a></p><p id="par0035" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">ADIPOQ</span> is located on the long arm of the chromosome 3&#44; locus 3q27&#46;<a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> This gene is 17&#160;kb long and consists of 3 exons and 2 introns&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a><span class="elsevierStyleItalic">ADIPOQ</span> SNPs are associated with an increased risk of many diseases including atherosclerosis&#44;<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> rheumatoid arthritis&#44;<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> acne vulgaris<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> and atopic dermatitis&#44;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> but have not evaluated in AA until now&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall">The aim of this study was to elucidate the possible role of adiponectin in AA through assessment of <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; gene polymorphism in relation to its serum level in a sample of Egyptian patients having AA&#44; as well as correlate the evaluated results with clinical aspects of AA including its site&#44; course and disease severity in those patients&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Methods</span><p id="par0045" class="elsevierStylePara elsevierViewall">The current case-control study was conducted on a total number of 150 subjects&#46; They included 75 patients with AA &#40;36 males and 39 females&#41; and 75 aged and sex-matched apparently healthy volunteers &#40;43 males and 32 females&#41; as a control group&#46; They were collected from the Dermatology Outpatient Clinic&#44; Menoufia University Hospital during the period from March 2022 to February 2023&#46; The laboratory part of the study was done at the Medical Biochemistry and Molecular Biology Department&#44; Faculty of Medicine&#44; Menoufia University&#46;</p><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Administrative and ethical design</span><p id="par0050" class="elsevierStylePara elsevierViewall"><ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">&#8226;</span><p id="par0055" class="elsevierStylePara elsevierViewall">A written consent was obtained from all participants after being informed about the aim and process of the study as well as applicable objectives&#46;</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">&#8226;</span><p id="par0060" class="elsevierStylePara elsevierViewall">The study had been approved by the local ethics committee on research involving human subjects of Menoufia Faculty of Medicine&#46; The ethical approval number is 3&#47;2022 DERMA 19&#46;</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">&#8226;</span><p id="par0065" class="elsevierStylePara elsevierViewall">The study procedures were free from any harmful effects on the participants as well as the service provided&#46;</p></li><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel">&#8226;</span><p id="par0070" class="elsevierStylePara elsevierViewall">The principal investigator has kept individual data as private information safely&#46; There was no extra fee to be paid by the participants and the investigator covered all the costs in this regard&#46;</p></li></ul></p><p id="par0075" class="elsevierStylePara elsevierViewall">Inclusion criteria were patients with variable degrees of AA severity from both sexes and aged 18 years or more&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">Any subject had one or more of the following was excluded from the study&#58; a&#41; Patients with a history of using any treatment that could impact the metabolic status within 3 months prior to the examination e&#46;g&#46;&#44; hormonal therapy and systemic treatment such as oral prednisolone therapy&#46; b&#41; Patients with other autoimmune diseases e&#46;g&#46; Hashimoto&#39;s thyroiditis and vitiligo&#46; c&#41; Pregnant and lactating women&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Methods</span><p id="par0085" class="elsevierStylePara elsevierViewall">Each of the selected cases was subjected to history taking and complete general examination&#46; Body Mass Index &#40;BMI&#41; was calculated &#91;BMI&#160;&#61;&#160;weight &#40;kg&#41;&#47;height &#40;m&#41;<span class="elsevierStyleSup">2</span>&#93;&#46;<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a></p><p id="par0090" class="elsevierStylePara elsevierViewall">Diagnosis of AA was done clinically by 2 expert dermatologists&#46; Distribution of the AA lesions was evaluated by determination of its site &#40;scalp&#44; beard&#44; eyebrow&#44; and&#47;or any hairy areas all over the body&#41;&#46; Clinical variants of AA &#40;patchy AA&#44; A totalis&#44; A universalis&#44; ophiasis&#44; sisaipho&#41; were recorded&#46; Clinical assessment of the disease severity and extent was done based on SALT score&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a> In which the scalp was divided into four sections&#58; right &#40;18&#37;&#41;&#44; left &#40;18&#37;&#41;&#44; back &#40;24&#37;&#41; and top &#40;40&#37;&#41;&#46; For each section&#44; the percent of the area of the hair involved was estimated and then transformed into a grade from S0 to S5&#46; SALT score was calculated by multiplying the percentage of hair loss in each of the 4 quadrants of the scalp by the quadrant surface area&#46; Then the 4 values were added together for a total score&#46; The SALT score ranged from 0&#37; to 100&#37;&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">After 12&#160;hours fasting&#44; six mL of venous blood were collected from every participant&#44; under complete aseptic condition&#46; Each sample was divided into 2 parts&#46; One &#40;3&#160;mL&#41; for DNA extraction was kept in EDTA tube&#46; The other part &#40;3&#160;mL&#41; was put in a plain tube&#44; left to clot for 30&#160;minutes at room temperature&#44; then underwent centrifugation for 10&#160;minutes at 4000 rotations per minute and the serum obtained was divided into a liquor&#44; stored at &#8722;80&#160;&#176;C until the time for Fasting Blood Glucose &#40;FBG&#41;&#44; lipid profile and serum adiponectin analysis&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">Blood glucose was determined by enzymatic colorimetric test&#46; Glucose is oxidized by glucose oxidase to glucuronic acid and hydrogen peroxide&#46; Then&#44; the formed hydrogen peroxide is detected by a chromogenic oxygen acceptor&#44; phenol aminophenazone in the presence of peroxidase&#58; produces Quinonimine which is a colored compound the intensity of the color is directly proportional to the amount of glucose in the sample&#46; The absorbance of the sample and standard test was measured by a spectrophotometer instrument and the concentration of the glucose in the sample was determined&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">25</span></a><elsevierMultimedia ident="eq0005"></elsevierMultimedia><elsevierMultimedia ident="eq0010"></elsevierMultimedia></p><p id="par0105" class="elsevierStylePara elsevierViewall">Quantitative estimation of Total Cholesterol &#40;TC&#41;&#44; High-Density Lipoprotein &#40;HDL&#41; and Triglyceride &#40;TG&#41; using colorimetric enzymatic method&#44; using standard enzymatic colorimetric kits &#40;Spinreact diagnostic kit&#44; Spain&#41; and low-density lipoprotein was elaborated by Modified Friedewald et al&#46; equation&#46;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a></p><p id="par0110" class="elsevierStylePara elsevierViewall">Detection of adiponectin serum level was done by enzyme-linked immunosorbent assay &#40;ELISA&#41;&#46; The kit &#40;made in China&#44; Sun Red Company&#41; uses a double-antibody sandwich ELISA&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">Assessment of <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; genetic variants was carried out by real-time PCR&#46; DNA extraction from whole blood by Quick-genomic DNATM MiniPrep kit&#44; Zymo Research&#46; Genotyping of <span class="elsevierStyleItalic">ADIPOQ &#40;rs2241766&#41;</span> was completed by allelic discrimination assay utilizing TaqMan probes &#40;Applied Biosystems&#44; USA&#41;&#46; An overall mixture of 25&#160;&#956;L was conducted by applying 5&#160;&#956;L of sample DNA to a mixture of 12&#46;5&#160;&#956;L of genotyping master mix&#44; 1&#46;25&#160;&#956;L of SNP assay and 6&#46;25&#160;&#956;L of nuclease-free water&#46; The TaqMan probes were labeled with VIC and FAM &#64258;uorescent dyes&#46; The probe sequence for <span class="elsevierStyleItalic">ADIPOQ &#40;rs2241766&#41;</span> was TTCTACTGCTATTAGCTCTGCCCGG &#91;T&#47;G&#93; CATGACCAGGAAACCACGACTCAAG&#59; Cycling provisions were completed as&#58; initial 95&#160;&#176;C for 10&#160;minutes as a primary denaturation step followed by 45 cycles of 15 seconds at 95&#160;&#176;C and 60 seconds at 60&#160;&#176;C &#40;cycling&#41;&#44; and a final extension step for 60 seconds at 60&#160;&#176;C&#46; The Sequence Detection System implements the fluorescence emitted during the plate read and the fluorescence &#40;Rn&#41; values were plotted depending on the signals from each well&#46; Each well of the 96-well reaction plate is an individual point on the plot&#46; Fluorescence detection and data analysis were carried out by 7500 Real-Time PCR instrument &#40;Applied Biosystems&#41; version 2&#46;0&#46;1&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Statistical analysis</span><p id="par0120" class="elsevierStylePara elsevierViewall">Data were collected&#44; tabulated&#44; and statistically analyzed using an international business machine corporation personal computer with Statistical Package of Social Science &#40;SPSS&#41; version 22 &#40;SPSS&#44; Inc&#44; Chicago&#44; Illinois&#44; USA&#41;&#46; The following statistics were applied&#58; a&#41; Descriptive statistics&#58; in which quantitative data were presented in the form of mean&#44; Standard Deviation &#40;SD&#41;&#44; range&#44; and qualitative data were presented in the form of numbers and percentages&#46; b&#41; Analytical statistics&#58; was used to find out the possible association between studied factors and the targeted disease&#46; The used tests of significance included&#58; Chi-Square test &#40;&#967;2&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> Student <span class="elsevierStyleItalic">t</span>-test &#40;<span class="elsevierStyleItalic">t</span>&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">28</span></a> Mann-Whitney test &#40;<span class="elsevierStyleItalic">U</span>&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">29</span></a> Kruskal Wallis test<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">30</span></a>&#59; p-value of was considered significant if it was &#8804; 0&#46;05&#46;</p></span></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Results</span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Personal and clinical data of the investigated subjects</span><p id="par0125" class="elsevierStylePara elsevierViewall">AA patients were 36 &#40;48&#37;&#41; males and 39 &#40;52&#37;&#41; females with a male&#58; female ratio of 1&#58;1&#46;08&#46; Their age ranged from 22 to 53 years with 32&#46;4&#160;&#177;&#160;7&#46;14 years as a mean&#160;&#177;&#160;SD value&#46; Control subjects were 43 &#40;57&#46;3&#37;&#41; males and 32 &#40;42&#46;7&#37;&#41; females with a male&#58; female ratio of 1&#46;34&#58;1&#46; Their age ranged from 18 to 54 years with 32&#46;7&#160;&#177;&#160;9&#46;11 years as a mean&#160;&#177;&#160;SD value&#46; There were non-statistically significant differences between cases and controls regarding their age &#40;p&#160;&#61;&#160;0&#46;956&#41; and sex &#40;p&#160;&#61;&#160;0&#46;252&#41;&#46; <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a> demonstrates the clinical data of AA patients &#40;n&#160;&#61;&#160;75&#41;&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">BMI&#44; blood pressure and laboratory investigations of the studied subjects</span><p id="par0130" class="elsevierStylePara elsevierViewall">There were non-significant differences between AA patients and controls regarding their BMI &#40;p&#160;&#61;&#160;0&#46;131&#41;&#44; systolic blood pressure &#40;p&#160;&#61;&#160;0&#46;665&#41;&#44; diastolic blood pressure &#40;p&#160;&#61;&#160;0&#46;304&#41;&#44; fasting blood glucose &#40;p&#160;&#61;&#160;0&#46;171&#41;&#44; triglycerides &#40;p&#160;&#61;&#160;0&#46;097&#41; and low-density lipoprotein &#40;p&#160;&#61;&#160;0&#46;347&#41;&#46; While there was a significant elevation in total cholesterol &#40;p&#160;&#61;&#160;0&#46;019&#41; and a significant decrease in high-density lipoprotein &#40;p&#160;&#61;&#160;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Serum adiponectin levels and <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; of the studied subjects</span><p id="par0135" class="elsevierStylePara elsevierViewall">Serum adiponectin levels weresignificantly lower in AA patients than in controls &#40;9&#46;45&#160;&#177;&#160;4&#46;12 vs&#46; 13&#46;8&#160;&#177;&#160;5&#46;62&#160;ng&#47;mL&#41; &#40;p&#160;&#61;&#160;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0140" class="elsevierStylePara elsevierViewall">Studying <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; gene polymorphism showed that there was a significant difference between AA patients and controls&#46; <span class="elsevierStyleItalic">TG</span> genotype was present in 31 &#40;41&#46;3&#37;&#41; AA patients versus 9 &#40;12&#46;0&#37;&#41; controls&#46; The presence of <span class="elsevierStyleItalic">TG</span> genotype significantly increased the risk for AA by about 5 folds &#40;OR&#160;&#61;&#160;5&#46;17&#44; p&#160;&#61;&#160;0&#46;001&#41;&#46; Also&#44; <span class="elsevierStyleItalic">G</span>allele significantly increases the risk for AA by about 4 folds &#40;OR&#160;&#61;&#160;3&#46;82&#44; p&#160;&#61;&#160;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Adiponectin serum levels in relation to studied data of AA patients</span><p id="par0145" class="elsevierStylePara elsevierViewall">There were non-significant relations between serum adiponectin level and the investigated data of AA patients except for the type of alopecia &#40;significantly lower in alopecia totalis &#91;p&#160;&#61;&#160;0&#46;016&#93;&#41; and SALT score &#91;a significant negative correlation &#40;<span class="elsevierStyleItalic">r</span> &#61; -0&#46;435&#44; p&#160;&#61;&#160;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41;&#46; Serum adiponectin level was significantly lower in AA patients with <span class="elsevierStyleItalic">TG</span> genotype than in cases having <span class="elsevierStyleItalic">TT</span> genotype &#40;5&#46;33&#160;&#177;&#160;2&#46;02 vs&#46; 12&#46;3&#160;&#177;&#160;2&#46;34&#41; &#40;p&#160;&#61;&#160;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A&#41;&#46;</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Relationship between <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; genotypes and studied data of AA patients</span><p id="par0150" class="elsevierStylePara elsevierViewall">There were non-significant relationships between <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; genotypes and any of the clinical data of studied AA patients except for the SALT score that was significantly higher in <span class="elsevierStyleItalic">TG</span> genotype carriers than <span class="elsevierStyleItalic">TT</span> carrier cases &#40;p&#160;&#61;&#160;0&#46;001&#41; &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>B&#41;&#46;</p></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Discussion</span><p id="par0155" class="elsevierStylePara elsevierViewall">In the current study&#44; <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; SNP was strongly related to adiponectin serum concentrations in AA patients&#44; and associated with the disease severity&#46; By this study&#44; we have shownthat <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; SNP could modulate AA risk and contribute to the development of AA in Egyptian populations that had not previously been identified&#44; and we confirmed that decreased circulating adiponectin levels may have an active role in AA etiopathogenesis&#46; Confirmatory studies are necessary to make sure that the observed associations are true rather than spurious&#46;</p><p id="par0160" class="elsevierStylePara elsevierViewall">Metabolism and the immune system are connected via a network of numerous soluble mediators known as adipokines&#46; These adipokines are regarded as bad and good adipokines&#46; Bad adipokines are pro-inflammatory and produce insulin resistance&#44; vascular dysfunction&#44; and local inflammatory reactions that support cutaneous inflammation&#46; On the other hand&#44; good adipokines have opposed properties&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a></p><p id="par0165" class="elsevierStylePara elsevierViewall">Here in&#44; we considered adiponectin as a good adipokine&#46; We found a significant decrease in its circulating levels in AA patients than controls&#44; and this low concentration was more observed with more severe disease and in alopecia totalis cases&#46;</p><p id="par0170" class="elsevierStylePara elsevierViewall">Confirming these observations&#44; Stochmal et al&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> demonstrated a significant decrease in adiponectin serum levels in AA patients than their matched peers&#46; They also reported that adiponectin serum level was negatively correlated with SALT score and had its lowest concentration in patients with alopecia universalis&#46; The decreased levels of serum adiponectin were also described in patients with Sjogren&#8217;s syndrome&#44; psoriatic arthritis&#44; and multiple sclerosis&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a></p><p id="par0175" class="elsevierStylePara elsevierViewall">Adiponectin&#44; a serum protein&#44; is produced mostly by adipocytes&#46; But&#44; other cells such as the fibroblasts&#44; endothelial cells&#44; macrophages&#44; and leukocytes also may synthesize adiponectin&#46;<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">33</span></a> Adiponectin consumes an anti-inflammatory influence&#46; It reduces B-cell lymphopoiesis and T-cell responsiveness&#44; as well as TNF-&#945; synthesis&#46; It also stimulates IL-10 production&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a></p><p id="par0180" class="elsevierStylePara elsevierViewall">AA pathogenesis is not completely assumed&#46; It appears that immune system activation is considered one of the main biological processes connected to the pathogenesis of AA&#46;<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">34</span></a> In AA the unusual levels of many pro-inflammatory cytokines e&#46;g&#46; IL-6 and TNF-&#945; and anti-inflammatory ones as IL-10 were confirmed&#46;<a class="elsevierStyleCrossRefs" href="#bib0175"><span class="elsevierStyleSup">35&#44;36</span></a> It appears that cytokine production disequilibrium&#44; with a relative excess of pro-inflammatory versus low anti-inflammatory cytokines&#44; could have an active role in AA development&#46;<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">37</span></a></p><p id="par0185" class="elsevierStylePara elsevierViewall">TNF-&#945; is a normal in vitro inhibitor of hair follicle growth&#46; TNF-&#945;&#44; together with IL-1&#945; and -&#946;&#44; induces matrix cell vacuolation within the bulb of the hair follicle and decreases the matrix size&#46; It also disorganizes the follicular melanocytes and induces abnormal differentiation in the inner root sheath and precortical cells&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">38</span></a> It was reported that TNF-&#945; serum<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">39</span></a> and tissue<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">38</span></a> levels in patients with AA were significantly higher than controls&#46;</p><p id="par0190" class="elsevierStylePara elsevierViewall">Thus&#44; we hypothesized that in AA&#44; adiponectin could act as an anti-inflammatory molecule&#44; and the current demonstrated low adiponectin serum levels in AA patients may be translated into a repressed anti-inflammatory activity&#46; Impaired adiponectin levels may influence numerous processes within the hair follicle environment leading to local autoimmune response resulting in exacerbated hair loss&#46;</p><p id="par0195" class="elsevierStylePara elsevierViewall">However&#44; Serarslan et al&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> did not show significant differences in adiponectin concentration in patients with AA compared to healthy controls&#46; Moreover&#44; we showed higher serum levels of adiponectin in patients with scalp hair loss compared to those with isolated AA in the beard and eyebrow&#46; The authors said that their result was an unexpected finding&#46; They added that&#44; as in RA&#44; where adiponectin serum and synovial levels were increased&#44; adiponectin is suggested to increase the production of inflammatory mediators&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">40</span></a> These controversial results need more similar large-scale studies to verify&#46;</p><p id="par0200" class="elsevierStylePara elsevierViewall">In the present work we analyzed&#44; for the first time&#44; <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; SNP in AA patients&#44; and correlated its genotypes with the AA severity&#44; site&#44; progression&#44; and disease duration as well as with adiponectin serum level&#46; We found that the <span class="elsevierStyleItalic">TG</span> genotype was significantly present in AA patients increasing its risk by about 5 folds&#44; and the <span class="elsevierStyleItalic">G</span> allele significantly increased the risk by about 4 folds&#46; Moreover&#44; <span class="elsevierStyleItalic">ADIPOQ &#40;rs2241766&#41;</span><span class="elsevierStyleItalic">TG</span> genotype carriers demonstrated significantly low adiponectin serum levels and a severe form of AA&#46; Therefore&#44; we suggested that <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; gene polymorphism contributes not only to the development of AA&#44; but also to its severity&#44; that is mediated through dysregulation of adiponectin transcription&#46;</p><p id="par0205" class="elsevierStylePara elsevierViewall">Supporting these results&#44; Saleh et al&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">41</span></a> revealed that <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; mutant alleles were linked to diminished circulatory adiponectin levels in cases having myocardial infarctions&#46; Furthermore&#44; Al-Shaheri et al&#46;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> found that <span class="elsevierStyleItalic">ADIPOQ</span>rs2241766 and rs3774261 SNPs increase the risk of atopic dermatitis&#46; Previously&#44; Wassel et al&#46;<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">42</span></a> reported that adiponectin SNPs rs17300539&#44; rs182052&#44; rs822393&#44; rs9882205&#44; and rs3774261 were strongly associated with adiponectin serum concentrations in whites&#46;</p><p id="par0210" class="elsevierStylePara elsevierViewall">The study limitations were&#58; a&#41; The small sample size&#44; b&#41; The study is structurally a case-control one&#44; and c&#41; The authors evaluated only a single adipokine rather than multiple ones&#46;</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Conclusion</span><p id="par0215" class="elsevierStylePara elsevierViewall">It seems that <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; gene polymorphism &#40;<span class="elsevierStyleItalic">TG</span> genotype and <span class="elsevierStyleItalic">G</span> allele&#41; may modulate AA risk and contribute to the development of AA in Egyptian populations&#46; Decreased circulating adiponectin levels may have a dynamic role in AA etiopathogenesis that could possibly be mediated via its anti-inflammatory effects&#46; Adiponectin serum concentration can be considered a severity marker of hair loss in AA&#46;</p></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Financial support</span><p id="par0220" class="elsevierStylePara elsevierViewall">None declared&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Authors&#8217; contributions</span><p id="par0225" class="elsevierStylePara elsevierViewall">Azza Gaber Antar Farag&#58; Critical literature review&#59; study conception and planning&#46;</p><p id="par0230" class="elsevierStylePara elsevierViewall">Eman Abd-Elfatah Badr labeeb&#58; Data analysis and interpretation&#46;</p><p id="par0235" class="elsevierStylePara elsevierViewall">Banan Mohamed Gamal Abd-Elaty&#58; Data collection</p><p id="par0240" class="elsevierStylePara elsevierViewall">Nada Farag Elnaidany&#58; Statistical analysis&#46;</p><p id="par0245" class="elsevierStylePara elsevierViewall">Mai Medhat Mohamed Ghanem&#58; Data analysis and interpretation&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Conflicts of interest</span><p id="par0250" class="elsevierStylePara elsevierViewall">None declared&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres2208082"
          "titulo" => "Abstract"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Objective"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Study limitations"
            ]
            5 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1852489"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Methods"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Administrative and ethical design"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:3 [
          "identificador" => "sec0030"
          "titulo" => "Results"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Personal and clinical data of the investigated subjects"
            ]
            1 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "BMI&#44; blood pressure and laboratory investigations of the studied subjects"
            ]
            2 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Serum adiponectin levels and ADIPOQ &#40;rs2241766&#41; of the studied subjects"
            ]
            3 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Adiponectin serum levels in relation to studied data of AA patients"
            ]
            4 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Relationship between ADIPOQ &#40;rs2241766&#41; genotypes and studied data of AA patients"
            ]
          ]
        ]
        5 => array:2 [
          "identificador" => "sec0060"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0065"
          "titulo" => "Conclusion"
        ]
        7 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Financial support"
        ]
        8 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Authors&#8217; contributions"
        ]
        9 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Conflicts of interest"
        ]
        10 => array:2 [
          "identificador" => "xack761223"
          "titulo" => "Acknowledgment"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2023-03-29"
    "fechaAceptado" => "2023-05-25"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1852489"
          "palabras" => array:3 [
            0 => "Adiponectin"
            1 => "Alopecia areata"
            2 => "Genetics"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Alopecia Areata &#40;AA&#41; is an acquired autoimmune form of non-scarring hair loss&#46; Adiponectin and its gene polymorphism were related to many autoimmune disorders&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Objective</span><p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Assessment of adiponectin serum levels and adiponectin gene &#40;<span class="elsevierStyleItalic">ADIPOQ</span>&#41; &#40;rs2241766&#41; Single Nucleoid Polymorphism &#40;SNP&#41; in AA patients and correlating the results with the disease severity in those patients&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">This study included 75 AA patients and 75 age and gender-matched healthy subjects &#40;controls&#41;&#46; The severity of Alopecia Tool &#40;SALT&#41; score assessment to evaluate AA severity was done&#46; Adiponectin serum levels by ELISA and <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; SNP using PCR were performed&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Adiponectin serum levels were significantly lower in AA patients than controls &#40;p&#160;&#61;&#160;0&#46;001&#41;&#46; <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; <span class="elsevierStyleItalic">TG</span> genotype and <span class="elsevierStyleItalic">G</span> allele were significantly predominant in AA patients increasing its risk by 5 and 4 folds &#40;OR&#160;&#61;&#160;5&#46;17&#44; p&#160;&#61;&#160;0&#46;001&#41;&#44; &#40;OR&#160;&#61;&#160;3&#46;82&#44; p&#160;&#61;&#160;0&#46;001&#41; respectively&#46; Serum adiponectin levels were negatively correlated with SALT score &#40;<span class="elsevierStyleItalic">r</span> &#61; -0&#46;435&#44; p&#160;&#61;&#160;0&#46;001&#41; and associated with alopecia totalis &#40;p&#160;&#61;&#160;0&#46;016&#41;&#46; <span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; <span class="elsevierStyleItalic">TG</span> genotype was significantly associated with low serum adiponectin levels and higher SALT score &#40;p&#160;&#61;&#160;0&#46;001&#41;&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Study limitations</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">The small sample size&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Conclusions</span><p id="spar0075" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; gene polymorphism &#40;<span class="elsevierStyleItalic">TG</span> genotype and <span class="elsevierStyleItalic">G</span> allele&#41; may modulate AA risk and contribute to the development of AA in Egyptian populations&#46; Decreased circulating adiponectin levels may have a dynamic role in AA etiopathogenesis&#46; Adiponectin serum concentration can be considered a severity marker of hair loss in AA&#46;</p></span>"
        "secciones" => array:6 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Objective"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Study limitations"
          ]
          5 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Conclusions"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:2 [
        "etiqueta" => "&#8902;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Study conducted at the Dermatology&#44; Andrology and STDs Department&#44; and Medical Biochemistry and Molecular Biology Department&#44; Faculty of Medicine&#44; Menoufia University&#44; Egypt&#46;</p>"
      ]
    ]
    "multimedia" => array:7 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2429
            "Ancho" => 1675
            "Tamanyo" => 226700
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">ADIPOQ</span> &#40;rs2241766&#41; genotypes in relation to&#58; &#40;A&#41; Serum adiponectin levels among the studied AA patients&#46; &#40;B&#41; SALT score of studied AA patients&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">No&#44; Number&#59; &#37;&#44; Percentage&#59; SD&#44; Standard Deviation&#59; AA&#44; Alopecia Areata&#59; SALT&#44; Severity of Alopecia Areata Tool&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Studied variables&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">NO</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&#37;</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">AA patients&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&#40;No&#160;&#61;&#160;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Gender</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">36&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">39&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">52&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Age &#47; years</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&#46;4&#160;&#177;&#160;7&#46;14</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31&#46;0</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22&#46;0 &#8211; 53&#46;0</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Onset</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sudden&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">95&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">78&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Gradual&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Course of the disease</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Progressive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">44&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">58&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Stationary&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Duration &#47; months</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&#46;3&#160;&#177;&#160;6&#46;80</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&#46;0</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;00 &#8211; 36&#46;0</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Family history</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">66&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">88&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Type of alopecia</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Patchy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">71&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Totalis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ophiasis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Associations</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anxiety&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">53&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">70&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Depression&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Atopy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Nail changes</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Beau line&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nail bitting&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nail ridding&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Punctuate leukonychia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Trachyonychia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;70&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">80&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">SALT score</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17&#46;2&#160;&#177;&#160;31&#46;9</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;80</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;60 &#8211; 100&#46;0</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3602783.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Personal and clinical data of AA patients &#40;n&#160;&#61;&#160;75&#41;&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">SD&#44; Standard Deviation&#59; U&#44; Mann Whitney test&#59; BMI&#44; Body Mass Index&#59; FBG&#44; Fasting Blood Glucose&#59; TG&#44; Triglyceride&#59; HDL&#44; High Density Lipoprotein&#59; DL&#44; Low Density Lipoprotein&#59; AA&#44; Alopecia Areata&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Studied variables&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">AA patients &#40;No&#160;&#61;&#160;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;No&#160;&#61;&#160;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mann Whitney test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">BMI &#40;</span>kg&#47;m<span class="elsevierStyleSup">2</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24&#46;7&#160;&#177;&#160;3&#46;96&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22&#46;3&#160;&#177;&#160;2&#46;04&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;51&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;131&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18&#46;0 &#8211; 35&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19&#46;0 &#8211; 26&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Systolic blood pressure</span> &#40;mmHg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">118&#46;5&#160;&#177;&#160;10&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">118&#46;4&#160;&#177;&#160;9&#46;65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">120&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">120&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;432&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;665&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">90&#46;0 &#8211; 135&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">90&#46;0 &#8211; 135&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Diastolic blood pressure</span> &#40;mmHg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">80&#46;9&#160;&#177;&#160;5&#46;85&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">79&#46;8&#160;&#177;&#160;5&#46;60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">80&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">80&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;02&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;304&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&#46;0 &#8211; 90&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&#46;0 &#8211; 90&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Fasting Blood Glucose &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">88&#46;3&#160;&#177;&#160;8&#46;22&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">91&#46;6&#160;&#177;&#160;11&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">89&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">90&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;36&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;171&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">73&#46;0 &#8211; 103&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">73&#46;0 &#8211; 125&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Triglyceride &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">128&#46;7&#160;&#177;&#160;13&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">123&#46;4&#160;&#177;&#160;21&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">129&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">125&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;097&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100&#46;0 &#8211; 152&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">89&#46;0 &#8211; 170&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Total cholesterol &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">149&#46;8&#160;&#177;&#160;24&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">140&#46;5&#160;&#177;&#160;22&#46;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">150&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">140&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;019&#42;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">111&#46;0 &#8211; 196&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">110&#46;0 &#8211; 200&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">HDLc &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">66&#46;2&#160;&#177;&#160;4&#46;15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">73&#46;7&#160;&#177;&#160;6&#46;69&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">66&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">75&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;86&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001&#42;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&#46;0 &#8211; 77&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">60&#46;0 &#8211; 88&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">LDLc &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">87&#46;8&#160;&#177;&#160;9&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">85&#46;8&#160;&#177;&#160;10&#46;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">90&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">87&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;941&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;347&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">69&#46;0 &#8211; 102&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">47&#46;0 &#8211; 104&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3602784.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Comparison between AA patients and controls regarding their BMI&#44; blood pressure and laboratory investigations &#40;n&#160;&#61;&#160;150&#41;&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0020"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">AA&#44; Alopecia Areata&#59; No&#46;&#44; Number&#59; &#37;&#44; Percentage&#59; &#967;<span class="elsevierStyleSup">2</span>&#44; Chi square test&#59; OR&#44; Odds Ratio&#59; CI&#44; Confidence interval&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Studied variables&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">AA patients &#40;No&#160;&#61;&#160;75&#41;</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;No&#160;&#61;&#160;75&#41;</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Test&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">p-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">OR &#40;95&#37; CI&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Serum adiponectin levels &#40;ng&#47;mL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"></th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"></th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mann-Whitney&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mean&#160;&#177;&#160;SD&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;45&#160;&#177;&#160;4&#46;12</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&#46;8&#160;&#177;&#160;5&#46;62</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;38</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span></td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="3" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#8210;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Median&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;60</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&#46;6</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Range&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;80 &#8211; 15&#46;3</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;89 &#8210; 29&#46;5</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">ADIPOQ</span>&#160;&#40;rs2241766&#41; genotypes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">No&#46;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#37;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">No&#46;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#37;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#967;<span class="elsevierStyleSup">2</span></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">TT</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">44&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">58&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">66&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">88&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference <span class="elsevierStyleBold">5&#46;17 &#40;2&#46;24 &#8211; 11&#46;9&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">TG</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Alleles</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">N&#160;&#61;&#160;150</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#37;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">N&#160;&#61;&#160;150</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#37;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#967;<span class="elsevierStyleSup">2</span></span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">T</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">119&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">79&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">141&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&#46;9</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span></td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference <span class="elsevierStyleBold">3&#46;82 &#40;1&#46;75 &#8211; 8&#46;35&#41;</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">G</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3602786.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Comparison between AA patients and controls regarding serum adiponectin levels and <span class="elsevierStyleItalic">ADIPOQ</span>&#160;&#40;rs2241766&#41; gene SNP&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0025"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">SD&#44; Standard Deviation&#59; K&#44; Kruskal Wallis test&#59; U&#44; Mann Whitney test&#59; &#42;r&#44; Spearman&#8217;s correlation&#59; BMI&#44; Body Mass Index&#59; SBP&#44; Systolic Blood Pressure&#59; DBP&#44; Diastolic Blood Pressure&#59; HDL&#44; High Density Lipoprotein&#59; LDL&#44; Low Density Lipoprotein&#59; SALT&#44; Severity of Alopecia Areata Tool&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Studied variables</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Serum adiponectin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Test of significance</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">p-value</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Mean&#160;&#177;&#160;SD &#40;ng&#47;mL&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Gender</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;07&#160;&#177;&#160;3&#46;82&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">U</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;373&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;81&#160;&#177;&#160;4&#46;39&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;891&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Onset</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sudden&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;55&#160;&#177;&#160;4&#46;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;605&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Gradual&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;11&#160;&#177;&#160;4&#46;22&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;518&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Course of the disease</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Progressive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&#46;93&#160;&#177;&#160;4&#46;70&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">U</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;287&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Stationary&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&#46;2&#160;&#177;&#160;3&#46;02&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Family history</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Positive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&#46;4&#160;&#177;&#160;3&#46;75&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;546&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Negative&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;32&#160;&#177;&#160;4&#46;17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;603&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Type of alopecia</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ophiasis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&#46;4&#160;&#177;&#160;0&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Patchy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;69&#160;&#177;&#160;4&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">K&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;016&#42;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Totalis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;10&#160;&#177;&#160;0&#46;26&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&#46;31&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Associations</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Anxiety&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;90&#160;&#177;&#160;3&#46;68&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Depression&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;48&#160;&#177;&#160;4&#46;98&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">K&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;088&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Atopy&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;40&#160;&#177;&#160;0&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;55&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Nail changes</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Beau line&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&#46;8&#160;&#177;&#160;0&#46;92&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nail bitting&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9&#46;85&#160;&#177;&#160;6&#46;28&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">K&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;229&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nail ridding&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&#46;2&#160;&#177;&#160;2&#46;82&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;62&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Punctuate leukonychia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;70&#160;&#177;&#160;0&#46;51&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Trachyonychia&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&#46;25&#160;&#177;&#160;4&#46;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Age&#47;years</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">r</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">p-value</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age&#47;years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;183&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;115&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Disease duration&#47;months</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;025&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;833&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">BMI &#40;</span>kg&#47;m<span class="elsevierStyleSup">2</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;110&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;348&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">SBP</span> &#40;mmHg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;080&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;497&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">DBP</span> &#40;mmHg&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;122&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;340&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Fasting Blood sugar &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;171&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;143&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Triglyceride &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;085&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;471&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">Total cholesterol &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;143&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;220&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">HDLc &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;048&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;685&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">LDLc &#40;mg&#47;dL&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;032&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;787&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">SALT score</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">-0&#46;435&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab3602785.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Relation between serum adiponectin level and studied data of AA patients &#40;n&#160;&#61;&#160;75&#41;&#46;</p>"
        ]
      ]
      5 => array:5 [
        "identificador" => "eq0005"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:1 [
          "Quimica" => "Glucose&#160;&#43;&#160;O<span class="elsevierStyleInf">2</span>&#160;&#43;&#160;H<span class="elsevierStyleInf">2</span>O ----- glucose oxidase-- &#8594; H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#160;&#43;&#160;Gluconate"
        ]
      ]
      6 => array:5 [
        "identificador" => "eq0010"
        "tipo" => "MULTIMEDIAFORMULA"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Formula" => array:1 [
          "Quimica" => "2H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#160;&#43;&#160;phenol&#160;&#43;&#160;4-Ap ------- peroxidase --- &#8594; Quinonimine&#160;&#43;&#160;4H<span class="elsevierStyleInf">2</span>O"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:42 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alopecia areata&#58; an update on etiopathogenesis&#44; diagnosis&#44; and management"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "C&#46; Zhou"
                            1 => "X&#46; Li"
                            2 => "C&#46; Wang"
                            3 => "J&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s12016-021-08883-0"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Rev Allergy Immunol&#46;"
                        "fecha" => "2021"
                        "volumen" => "61"
                        "paginaInicial" => "403"
                        "paginaFinal" => "423"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34403083"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alopecia areata&#58; an autoimmune disease of multiple players"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "P&#46; Suchonwanit"
                            1 => "C&#46; Kositkuljorn"
                            2 => "C&#46; Pomsoong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Immunotargets Ther&#46;"
                        "fecha" => "2021"
                        "volumen" => "29"
                        "paginaInicial" => "299"
                        "paginaFinal" => "312"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Trichoscopy of alopecia areata&#58; an update"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46; Wa&#347;kiel"
                            1 => "A&#46; Rakowska"
                            2 => "M&#46; Sikora"
                            3 => "M&#46; Olszewska"
                            4 => "L&#46; Rudnicka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/1346-8138.14283"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Dermatol&#46;"
                        "fecha" => "2018"
                        "volumen" => "45"
                        "paginaInicial" => "692"
                        "paginaFinal" => "700"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29569271"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alopecia areata&#58; a multifactorial autoimmune condition"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46; Simakou"
                            1 => "J&#46;P&#46; Butcher"
                            2 => "S&#46; Reid"
                            3 => "F&#46;L&#46; Henriquez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaut.2018.12.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Autoimmun&#46;"
                        "fecha" => "2019"
                        "volumen" => "98"
                        "paginaInicial" => "74"
                        "paginaFinal" => "85"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30558963"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Comorbidities in pediatric alopecia areata"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46;Z&#46; Conic"
                            1 => "N&#46;L&#46; Tamashunas"
                            2 => "G&#46; Damiani"
                            3 => "G&#46; Fabbrocini"
                            4 => "M&#46; Cantelli"
                            5 => "Young Dermatologists Italian Network"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jdv.16727"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Eur Acad Dermatol Venereol&#46;"
                        "fecha" => "2020"
                        "volumen" => "34"
                        "paginaInicial" => "2898"
                        "paginaFinal" => "2901"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32531131"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adipose tissue&#44; adipokines&#44; and inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "G&#46; Fantuzzi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaci.2005.02.023"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Allergy Clin Immunol&#46;"
                        "fecha" => "2005"
                        "volumen" => "115"
                        "paginaInicial" => "911"
                        "paginaFinal" => "919"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15867843"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "AdipoR1 and AdipoR2 maintain membrane fluidity in most human cell types and independently of adiponectin"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Ruiz"
                            1 => "M&#46; St&#229;hlman"
                            2 => "J&#46; Bor&#233;n"
                            3 => "M&#46; Pilon"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Lipid Res&#46;"
                        "fecha" => "2019"
                        "volumen" => "60"
                        "paginaInicial" => "995"
                        "paginaFinal" => "1004"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adiponectin and Orexin-A as a potential immunity link between adipose tissue and central nervous system"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46; Polito"
                            1 => "E&#46; Nigro"
                            2 => "A&#46; Messina"
                            3 => "M&#46;L&#46; Monaco"
                            4 => "V&#46; Monda"
                            5 => "O&#46; Scudiero"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fphys.2018.00982"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Physiol&#46;"
                        "fecha" => "2018"
                        "volumen" => "9"
                        "paginaInicial" => "982"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30140232"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adiponectin receptor PAQR-2 signaling senses low temperature to promote C&#46; elegans longevity by regulating autophagy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;L&#46; Chen"
                            1 => "J&#46; Tao"
                            2 => "P&#46;J&#46; Zhao"
                            3 => "W&#46; Tang"
                            4 => "J&#46;P&#46; Xu"
                            5 => "K&#46;Q&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41467-019-10475-8"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Commun&#46;"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "paginaInicial" => "2602"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31197136"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serum levels of adipokines and cytokines in psoriasis patients&#58; a systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Bai"
                            1 => "W&#46; Zheng"
                            2 => "Y&#46; Dong"
                            3 => "J&#46; Wang"
                            4 => "M&#46;A&#46; Garstka"
                            5 => "R&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/oncotarget.22260"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncotarget&#46;"
                        "fecha" => "2017"
                        "volumen" => "9"
                        "paginaInicial" => "1266"
                        "paginaFinal" => "1278"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29416693"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of irisin in the relationship between psoriasis and insulin resistance"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "I&#46; Bulur"
                            1 => "H&#46;K&#46; Erdogan"
                            2 => "E&#46; Kocat&#252;rk"
                            3 => "Z&#46;N&#46; Saracoglu"
                            4 => "&#214;&#46; Alata&#351;"
                            5 => "P&#46; Yildiz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.23736/S0392-0488.16.05413-4"
                      "Revista" => array:6 [
                        "tituloSerie" => "G Ital Dermatol Venereol&#46;"
                        "fecha" => "2018"
                        "volumen" => "153"
                        "paginaInicial" => "477"
                        "paginaFinal" => "482"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27652568"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dietary glycemic factors&#44; insulin resistance&#44; and adiponectin levels in acne vulgaris"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46;A&#46; &#199;erman"
                            1 => "E&#46; Akta&#351;"
                            2 => "&#304;K&#46; Altunay"
                            3 => "J&#46;E&#46; Ar&#305;c&#305;"
                            4 => "A&#46; Tulunay"
                            5 => "F&#46;Y&#46; Ozturk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaad.2016.02.1220"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Am Acad Dermatol&#46;"
                        "fecha" => "2016"
                        "volumen" => "75"
                        "paginaInicial" => "155"
                        "paginaFinal" => "162"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27061046"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Suppressed adiponectin levels and increased adiponectin response to oral glucose load in lean women with severe acne normalizes after isotretinoin treatment"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "K&#46; Aydin"
                            1 => "F&#46; &#199;etin&#246;zman"
                            2 => "G&#46; Elcin"
                            3 => "D&#46;Y&#46; Aksoy"
                            4 => "F&#46; Ucar"
                            5 => "B&#46;O&#46; Yildiz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1159/000484168"
                      "Revista" => array:6 [
                        "tituloSerie" => "Dermatology&#46;"
                        "fecha" => "2017"
                        "volumen" => "233"
                        "paginaInicial" => "314"
                        "paginaFinal" => "319"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29190629"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between circulating adipokines and acne vulgaris&#58; a systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "H&#46;C&#46; Chang"
                            1 => "M&#46;H&#46; Lin"
                            2 => "Y&#46;C&#46; Huang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/ajd.13035"
                      "Revista" => array:6 [
                        "tituloSerie" => "Australas J Dermatol&#46;"
                        "fecha" => "2019"
                        "volumen" => "60"
                        "paginaInicial" => "e361"
                        "paginaFinal" => "4"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30957881"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adipokines as biomarkers of atopic dermatitis in adults"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;K&#46; Jaworek"
                            1 => "J&#46;C&#46; Szepietowski"
                            2 => "K&#46; Szafraniec"
                            3 => "M&#46; Jaworek"
                            4 => "P&#46; Ha&#322;ubiec"
                            5 => "A&#46; Wojas-Pelc"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/jcm9092858"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Med&#46;"
                        "fecha" => "2020"
                        "volumen" => "9"
                        "paginaInicial" => "2858"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32899610"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of adiponectin and leptin in patients with alopecia areata with scalp hair loss"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "G&#46; Serarslan"
                            1 => "O&#46; &#214;zcan"
                            2 => "E&#46; Okyay"
                            3 => "B&#46; &#220;nl&#252;"
                            4 => "M&#46; Karada&#287;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11845-020-02410-4"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ir J Med Sci&#46;"
                        "fecha" => "2021"
                        "volumen" => "190"
                        "paginaInicial" => "1015"
                        "paginaFinal" => "1020"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33083959"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adiponectin as a novel biomarker of disease severity in alopecia areata"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Stochmal"
                            1 => "A&#46; Wa&#347;kiel-Burnat"
                            2 => "S&#46; Chrostowska"
                            3 => "M&#46; Zaremba"
                            4 => "A&#46; Rakowska"
                            5 => "J&#46; Czuwara"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/s41598-021-92853-1"
                      "Revista" => array:5 [
                        "tituloSerie" => "Sci Rep&#46;"
                        "fecha" => "2021"
                        "volumen" => "11"
                        "paginaInicial" => "13809"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34226603"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of single nucleotide polymorphisms in ADIPOQ gene with risk of hypertension&#58; a systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Yu"
                            1 => "L&#46; Liu"
                            2 => "Z&#46; Li"
                            3 => "Y&#46; Wang"
                            4 => "W&#46; Zhang"
                            5 => "Y&#46; Jin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Mol Epidemiol Genet&#46;"
                        "fecha" => "2021"
                        "volumen" => "12"
                        "paginaInicial" => "90"
                        "paginaFinal" => "101"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34853633"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The association between adiponectin single nucleotide polymorphisms and side effects of isotretinoin in acne patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46; Garba"
                            1 => "O&#46;F&#46; Khabour"
                            2 => "K&#46;H&#46; Alzoubi"
                            3 => "A&#46; Abu-Siniyeh"
                            4 => "F&#46; Al-Qarqaz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Dermatol Res Pract&#46;"
                        "fecha" => "2020"
                        "volumen" => "2020"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adiponectin and atherosclerotic disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "K&#46; Shimada"
                            1 => "T&#46; Miyazaki"
                            2 => "H&#46; Daida"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cccn.2004.02.020"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Chim Acta&#46;"
                        "fecha" => "2004"
                        "volumen" => "344"
                        "paginaInicial" => "1"
                        "paginaFinal" => "12"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15149866"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of adiponectin and adiponectin receptor gene polymorphisms with rheumatoid arthritis in a Chinese population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;L&#46; Zhao"
                            1 => "T&#46;P&#46; Zhang"
                            2 => "J&#46; Wu"
                            3 => "B&#46;Z&#46; Li"
                            4 => "X&#46;M&#46; Li"
                            5 => "H&#46;F&#46; Pan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/postgradmedj-2018-136372"
                      "Revista" => array:6 [
                        "tituloSerie" => "Postgrad Med J&#46;"
                        "fecha" => "2020"
                        "volumen" => "96"
                        "paginaInicial" => "149"
                        "paginaFinal" => "155"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31563887"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Associations between rs2241766 and rs3774261 polymorphisms in ADIPOQ gene and atopic dermatitis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "F&#46; Al-Shaheri"
                            1 => "O&#46;F&#46; Khabour"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18388/abp.2020_6157"
                      "Revista" => array:6 [
                        "tituloSerie" => "Acta Biochim Pol&#46;"
                        "fecha" => "2022"
                        "volumen" => "69"
                        "paginaInicial" => "637"
                        "paginaFinal" => "677"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/35998284"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Obesity&#44; waist circumference&#44; weight change&#44; and the risk of psoriasis in women&#58; nurses&#8217; Health Study II"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46;R&#46; Setty"
                            1 => "G&#46; Curhan"
                            2 => "H&#46;K&#46; Choi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1001/archinte.167.15.1670"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Intern Med&#46;"
                        "fecha" => "2007"
                        "volumen" => "167"
                        "paginaInicial" => "1670"
                        "paginaFinal" => "1675"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17698691"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Alopecia areata investigational assessment guidelines--Part II&#46; National Alopecia Areata Foundation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46;A&#46; Olsen"
                            1 => "M&#46;K&#46; Hordinsky"
                            2 => "V&#46;H&#46; Price"
                            3 => "J&#46;L&#46; Roberts"
                            4 => "J&#46; Shapiro"
                            5 => "D&#46; Canfield"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaad.2003.09.032"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Am Acad Dermatol&#46;"
                        "fecha" => "2004"
                        "volumen" => "51"
                        "paginaInicial" => "440"
                        "paginaFinal" => "447"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15337988"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of the clinical laboratory in diabetes mellitus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "E&#46; Burtis"
                            1 => "M&#46; Santos-Rosa"
                            2 => "J&#46; Bienvenu"
                            3 => "J&#46; Whicher"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:7 [
                        "edicion" => "4<span class="elsevierStyleSup">th</span> ed"
                        "titulo" => "Tietz Textbook of Clinical Chemistry"
                        "fecha" => "2006"
                        "paginaInicial" => "837"
                        "paginaFinal" => "903"
                        "editorial" => "Mosby"
                        "editorialLocalizacion" => "St Louis&#44; MO"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New modified Friedewald formulae for estimating low-density lipoprotein cholesterol according to triglyceride levels&#58; extraction and validation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Ghasemi"
                            1 => "S&#46; Asgari"
                            2 => "F&#46; Hadaegh"
                            3 => "M&#46; Kheirandish"
                            4 => "I&#46; Azimzadeh"
                            5 => "F&#46; Azizi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s12020-018-1685-2"
                      "Revista" => array:6 [
                        "tituloSerie" => "Endocrine&#46;"
                        "fecha" => "2018"
                        "volumen" => "62"
                        "paginaInicial" => "404"
                        "paginaFinal" => "411"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30043091"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The chi-square test"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "N&#46; Pandis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ajodo.2016.08.009"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Orthod Dentofacial Orthop&#46;"
                        "fecha" => "2016"
                        "volumen" => "150"
                        "paginaInicial" => "898"
                        "paginaFinal" => "899"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27871717"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Using the Student&#8217;s t-test with extremely small sample sizes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "J&#46;C&#46;F&#46; De Winter"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Pract Assess Res Eval&#46;"
                        "fecha" => "2013"
                        "volumen" => "18"
                        "paginaInicial" => "10"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mann-Whitney U Test"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "P&#46;E&#46; McKnight"
                            1 => "J&#46; Najab"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Corsini Encyclopedia Psychol&#46;"
                        "fecha" => "2010"
                        "volumen" => "30"
                        "paginaInicial" => "1"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Methodology and application of the Kruskal-Wallis test"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "E&#46; Ostertagova"
                            1 => "O&#46; Ostertag"
                            2 => "J&#46; Kov&#225;&#269;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Appl Mech Mater&#46;"
                        "fecha" => "2014"
                        "volumen" => "611"
                        "paginaInicial" => "115"
                        "paginaFinal" => "120"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serum level of apelin-36 in psoriatic patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46;G&#46; Farag"
                            1 => "R&#46;A&#46; Hassan"
                            2 => "S&#46;E&#46; Solomon"
                            3 => "M&#46;A&#46; Mohamed"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Menoufia Med&#46;"
                        "fecha" => "2016"
                        "volumen" => "34"
                        "paginaInicial" => "926"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Adipokines influence the inflammatory balance in autoimmunity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "J&#46; Hutcheson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cyto.2015.04.004"
                      "Revista" => array:6 [
                        "tituloSerie" => "Cytokine&#46;"
                        "fecha" => "2015"
                        "volumen" => "75"
                        "paginaInicial" => "272"
                        "paginaFinal" => "279"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26044595"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of adipokines in systemic sclerosis&#58; a missing link&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46; &#379;&#243;&#322;kiewicz"
                            1 => "A&#46; Stochmal"
                            2 => "L&#46; Rudnicka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00403-019-01893-1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Dermatol Res&#46;"
                        "fecha" => "2019"
                        "volumen" => "311"
                        "paginaInicial" => "251"
                        "paginaFinal" => "263"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30806766"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of serum levels of IL-6&#44; IL-10&#44; and TNF-alpha in alopecia areata patients&#58; a systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46; Torkestani"
                            1 => "H&#46; Moghimi"
                            2 => "R&#46; Farsiabi"
                            3 => "S&#46; Khazaei"
                            4 => "M&#46;M&#46; Eftekharian"
                            5 => "E&#46; Dalvand"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Biomed Res Ther&#46;"
                        "fecha" => "2021"
                        "volumen" => "8"
                        "paginaInicial" => "4668"
                        "paginaFinal" => "4678"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Serum cytokine and chemokine profiles in patients with alopecia areata"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "O&#46; Bilgic"
                            1 => "A&#46; Sivrikaya"
                            2 => "A&#46; Unlu"
                            3 => "H&#46;C&#46; Altinyazar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3109/09546634.2015.1093591"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Dermatolog Treat&#46;"
                        "fecha" => "2016"
                        "volumen" => "27"
                        "paginaInicial" => "260"
                        "paginaFinal" => "263"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26367497"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The profile of cytokines &#40;IL-2&#44; IFN-&#947;&#44; IL-4&#44; IL-10&#44; IL-17A&#44; and IL-23&#41; in active alopecia areata"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "R&#46;K&#46; Gautam"
                            1 => "Y&#46; Singh"
                            2 => "A&#46; Gupta"
                            3 => "P&#46; Arora"
                            4 => "A&#46; Khurana"
                            5 => "A&#46; Chitkara"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jocd.12970"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Cosmet Dermatol&#46;"
                        "fecha" => "2020"
                        "volumen" => "19"
                        "paginaInicial" => "234"
                        "paginaFinal" => "240"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31087753"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0185"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of cytotoxic T cells in chronic alopecia areata"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C&#46; Bodemer"
                            1 => "M&#46; Peuchmaur"
                            2 => "S&#46; Fraitaig"
                            3 => "L&#46; Chatenoud"
                            4 => "N&#46; Brousse"
                            5 => "Y&#46; De Prost"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1046/j.1523-1747.2000.00828.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Invest Dermatol&#46;"
                        "fecha" => "2000"
                        "volumen" => "114"
                        "paginaInicial" => "112"
                        "paginaFinal" => "116"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10620125"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of tumor necrosis factor-alpha in nonlesional tissues of alopecia areata patients&#58; a prove for a systemic disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Y&#46;M&#46; Gohary"
                            1 => "D&#46;S&#46; Abdel Fattah"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4103/ijt.ijt_47_17"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Trichology&#46;"
                        "fecha" => "2017"
                        "volumen" => "9"
                        "paginaInicial" => "154"
                        "paginaFinal" => "159"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29118519"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "On the problem of pathogenetic heterogeneity of alopecia areata"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46; Koubanova"
                            1 => "A&#46; Gadjlgoroeva"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "LibroEditado" => array:4 [
                        "titulo" => "EHRS Brussels&#44; Conference abstracts"
                        "paginaInicial" => "13"
                        "conferencia" => "Jun 27-29"
                        "serieFecha" => "2002"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Changes in plasma levels of fat-derived hormones adiponectin&#44; leptin&#44; resistin and visfatin in patients with rheumatoid arthritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Otero"
                            1 => "R&#46; Lago"
                            2 => "R&#46; Gomez"
                            3 => "F&#46; Lago"
                            4 => "C&#46; Dieguez"
                            5 => "J&#46;J&#46; G&#243;mez-Reino"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/ard.2005.046540"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Rheum Dis&#46;"
                        "fecha" => "2006"
                        "volumen" => "65"
                        "paginaInicial" => "1198"
                        "paginaFinal" => "1201"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16414972"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            40 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "41"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of adiponectin gene and receptor polymorphisms and their mRNA levels with serum adiponectin level in myocardial infarction"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46;A&#46; Saleh"
                            1 => "S&#46;I&#46; Tayel"
                            2 => "A&#46;G&#46; Shalaby"
                            3 => "S&#46;S&#46; El Naidany"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/TACG.S282843"
                      "Revista" => array:6 [
                        "tituloSerie" => "Appl Clin Genet&#46;"
                        "fecha" => "2020"
                        "volumen" => "13"
                        "paginaInicial" => "241"
                        "paginaFinal" => "252"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33376382"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            41 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "42"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Variants in the adiponectin gene and serum adiponectin&#58; the coronary artery development in young adults &#40;CARDIA&#41; study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "C&#46;L&#46; Wassel"
                            1 => "J&#46;S&#46; Pankow"
                            2 => "D&#46;R&#46; Jacobs Jr&#46;"
                            3 => "M&#46;W&#46; Steffes"
                            4 => "N&#46; Li"
                            5 => "P&#46;J&#46; Schreiner"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/oby.2010.85"
                      "Revista" => array:6 [
                        "tituloSerie" => "Obesity &#40;Silver Spring&#41;&#46;"
                        "fecha" => "2010"
                        "volumen" => "18"
                        "paginaInicial" => "2333"
                        "paginaFinal" => "2338"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20395949"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack761223"
        "titulo" => "Acknowledgment"
        "texto" => "<p id="par0255" class="elsevierStylePara elsevierViewall">All authors are grateful to the Dermatology and Biochemistry Department technical and administrative staff at the Faculty of Medicine- Menoufia University who helped kindly throughout this work&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03650596/0000009900000002/v2_202407221312/S0365059623002325/v2_202407221312/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "89516"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Article"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03650596/0000009900000002/v2_202407221312/S0365059623002325/v2_202407221312/en/main.pdf?idApp=UINPBA00008Z&text.app=https://clinics.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623002325?idApp=UINPBA00008Z"
]
Share
Journal Information
Vol. 99. Issue 2.
Pages 181-188 (1 March 2024)
Visits
2803
Vol. 99. Issue 2.
Pages 181-188 (1 March 2024)
Original Article
Full text access
Adiponectin serum levels and ADIPOQ (rs2241766) polymorphism in alopecia areata Egyptian patients
Visits
2803
Azza Gaber Antar Faraga, Eman Abd-Elfatah Badrb, Banan Mohamed Gamal Abd-Elatyc, Nada Farag Elnaidanyd, Mai Medhat Mohamed Ghanema,
Corresponding author
mai_medhat251@yahoo.com

Corresponding author.
a Dermatology, Andrology and STDs Department, Faculty of Medicine, Menoufia University, Shebin El-Kom, Menoufia, Egypt
b Medical Biochemistry and Molecular Biology Department, Faculty of Medicine, Menoufia University, Shebin El-Kom, Menoufia, Egypt
c Dermatology Department, Sers El-Lian General Hospital, Ministry of Health, Sers El-Lian, Menoufia, Egypt
d Clinical Pharmacy department, Faculty of Pharmacy, Modern Sciences and Arts University, 6TH October, Egypt
This item has received
Article information
Abstract
Full Text
Bibliography
Download PDF
Statistics
Figures (1)
Tables (4)
Table 1. Personal and clinical data of AA patients (n = 75).
Table 2. Comparison between AA patients and controls regarding their BMI, blood pressure and laboratory investigations (n = 150).
Table 3. Comparison between AA patients and controls regarding serum adiponectin levels and ADIPOQ (rs2241766) gene SNP.
Table 4. Relation between serum adiponectin level and studied data of AA patients (n = 75).
Show moreShow less
Abstract
Background

Alopecia Areata (AA) is an acquired autoimmune form of non-scarring hair loss. Adiponectin and its gene polymorphism were related to many autoimmune disorders.

Objective

Assessment of adiponectin serum levels and adiponectin gene (ADIPOQ) (rs2241766) Single Nucleoid Polymorphism (SNP) in AA patients and correlating the results with the disease severity in those patients.

Methods

This study included 75 AA patients and 75 age and gender-matched healthy subjects (controls). The severity of Alopecia Tool (SALT) score assessment to evaluate AA severity was done. Adiponectin serum levels by ELISA and ADIPOQ (rs2241766) SNP using PCR were performed.

Results

Adiponectin serum levels were significantly lower in AA patients than controls (p = 0.001). ADIPOQ (rs2241766) TG genotype and G allele were significantly predominant in AA patients increasing its risk by 5 and 4 folds (OR = 5.17, p = 0.001), (OR = 3.82, p = 0.001) respectively. Serum adiponectin levels were negatively correlated with SALT score (r = -0.435, p = 0.001) and associated with alopecia totalis (p = 0.016). ADIPOQ (rs2241766) TG genotype was significantly associated with low serum adiponectin levels and higher SALT score (p = 0.001).

Study limitations

The small sample size.

Conclusions

ADIPOQ (rs2241766) gene polymorphism (TG genotype and G allele) may modulate AA risk and contribute to the development of AA in Egyptian populations. Decreased circulating adiponectin levels may have a dynamic role in AA etiopathogenesis. Adiponectin serum concentration can be considered a severity marker of hair loss in AA.

Keywords:
Adiponectin
Alopecia areata
Genetics
Full Text
Introduction

Alopecia areata represents a type of hair loss, in which the immune system mistakenly attacks hair follicles.1 The estimated prevalence of AA is approximately 1 in 1000 people, with a lifespan risk of about 2%.2 Both adults and children are affected by AA, with a similar rate in females and males.3

The exact etiology of AA remains elusive. It is considered an autoimmune disorder. The immune system in its entirety is influenced by many genetic and multiple environmental factors.4 AA is associated with an increased risk of metabolic comorbidities, suggesting that adipokines may play a role in AA pathogenesis.5

Adipose tissue is not an inert tissue. It actively produces adipokines. These adipokines, in addition to regulation of energy expenditure and insulin sensitivity, play an important role as regulators of many physiologic and pathologic processes, comprising inflammation and immunity.6

Adiponectin is an adipose tissue circulating adipokine that enhances insulin sensitivity.7 It is a protein having 224 amino acids. Adiponectin structure is made of a single-chain of trimmers; a variable N-terminal domain, a C-terminal globular domain, and a collagen domain. This trimer is enclosed by a bell-shaped structure.8

Adiponectin exerts many pleiotropic actions; it promotes insulin sensitivity, promotes apoptosis in carcinogenic cells, and has antioxidant and anti-inflammatory effects.9

A decreased blood level of adiponectin has been found in psoriasis,10,11 acne vulgaris,12–14 and atopic dermatitis.15 However, in AA only two recent studies were interested in investigating adiponectin serum levels in AA patients. Moreover, the two author groups reported controversial results.16,17

ADIPOQ is located on the long arm of the chromosome 3, locus 3q27.18 This gene is 17 kb long and consists of 3 exons and 2 introns.19ADIPOQ SNPs are associated with an increased risk of many diseases including atherosclerosis,20 rheumatoid arthritis,21 acne vulgaris19 and atopic dermatitis,22 but have not evaluated in AA until now.

The aim of this study was to elucidate the possible role of adiponectin in AA through assessment of ADIPOQ (rs2241766) gene polymorphism in relation to its serum level in a sample of Egyptian patients having AA, as well as correlate the evaluated results with clinical aspects of AA including its site, course and disease severity in those patients.

Methods

The current case-control study was conducted on a total number of 150 subjects. They included 75 patients with AA (36 males and 39 females) and 75 aged and sex-matched apparently healthy volunteers (43 males and 32 females) as a control group. They were collected from the Dermatology Outpatient Clinic, Menoufia University Hospital during the period from March 2022 to February 2023. The laboratory part of the study was done at the Medical Biochemistry and Molecular Biology Department, Faculty of Medicine, Menoufia University.

Administrative and ethical design

  • A written consent was obtained from all participants after being informed about the aim and process of the study as well as applicable objectives.

  • The study had been approved by the local ethics committee on research involving human subjects of Menoufia Faculty of Medicine. The ethical approval number is 3/2022 DERMA 19.

  • The study procedures were free from any harmful effects on the participants as well as the service provided.

  • The principal investigator has kept individual data as private information safely. There was no extra fee to be paid by the participants and the investigator covered all the costs in this regard.

Inclusion criteria were patients with variable degrees of AA severity from both sexes and aged 18 years or more.

Any subject had one or more of the following was excluded from the study: a) Patients with a history of using any treatment that could impact the metabolic status within 3 months prior to the examination e.g., hormonal therapy and systemic treatment such as oral prednisolone therapy. b) Patients with other autoimmune diseases e.g. Hashimoto's thyroiditis and vitiligo. c) Pregnant and lactating women.

Methods

Each of the selected cases was subjected to history taking and complete general examination. Body Mass Index (BMI) was calculated [BMI = weight (kg)/height (m)2].23

Diagnosis of AA was done clinically by 2 expert dermatologists. Distribution of the AA lesions was evaluated by determination of its site (scalp, beard, eyebrow, and/or any hairy areas all over the body). Clinical variants of AA (patchy AA, A totalis, A universalis, ophiasis, sisaipho) were recorded. Clinical assessment of the disease severity and extent was done based on SALT score.24 In which the scalp was divided into four sections: right (18%), left (18%), back (24%) and top (40%). For each section, the percent of the area of the hair involved was estimated and then transformed into a grade from S0 to S5. SALT score was calculated by multiplying the percentage of hair loss in each of the 4 quadrants of the scalp by the quadrant surface area. Then the 4 values were added together for a total score. The SALT score ranged from 0% to 100%.

After 12 hours fasting, six mL of venous blood were collected from every participant, under complete aseptic condition. Each sample was divided into 2 parts. One (3 mL) for DNA extraction was kept in EDTA tube. The other part (3 mL) was put in a plain tube, left to clot for 30 minutes at room temperature, then underwent centrifugation for 10 minutes at 4000 rotations per minute and the serum obtained was divided into a liquor, stored at −80 °C until the time for Fasting Blood Glucose (FBG), lipid profile and serum adiponectin analysis.

Blood glucose was determined by enzymatic colorimetric test. Glucose is oxidized by glucose oxidase to glucuronic acid and hydrogen peroxide. Then, the formed hydrogen peroxide is detected by a chromogenic oxygen acceptor, phenol aminophenazone in the presence of peroxidase: produces Quinonimine which is a colored compound the intensity of the color is directly proportional to the amount of glucose in the sample. The absorbance of the sample and standard test was measured by a spectrophotometer instrument and the concentration of the glucose in the sample was determined.25

Glucose + O2 + H2O ----- glucose oxidase-- → H2O2 + Gluconate
2H2O2 + phenol + 4-Ap ------- peroxidase --- → Quinonimine + 4H2O

Quantitative estimation of Total Cholesterol (TC), High-Density Lipoprotein (HDL) and Triglyceride (TG) using colorimetric enzymatic method, using standard enzymatic colorimetric kits (Spinreact diagnostic kit, Spain) and low-density lipoprotein was elaborated by Modified Friedewald et al. equation.26

Detection of adiponectin serum level was done by enzyme-linked immunosorbent assay (ELISA). The kit (made in China, Sun Red Company) uses a double-antibody sandwich ELISA.

Assessment of ADIPOQ (rs2241766) genetic variants was carried out by real-time PCR. DNA extraction from whole blood by Quick-genomic DNATM MiniPrep kit, Zymo Research. Genotyping of ADIPOQ (rs2241766) was completed by allelic discrimination assay utilizing TaqMan probes (Applied Biosystems, USA). An overall mixture of 25 μL was conducted by applying 5 μL of sample DNA to a mixture of 12.5 μL of genotyping master mix, 1.25 μL of SNP assay and 6.25 μL of nuclease-free water. The TaqMan probes were labeled with VIC and FAM fluorescent dyes. The probe sequence for ADIPOQ (rs2241766) was TTCTACTGCTATTAGCTCTGCCCGG [T/G] CATGACCAGGAAACCACGACTCAAG; Cycling provisions were completed as: initial 95 °C for 10 minutes as a primary denaturation step followed by 45 cycles of 15 seconds at 95 °C and 60 seconds at 60 °C (cycling), and a final extension step for 60 seconds at 60 °C. The Sequence Detection System implements the fluorescence emitted during the plate read and the fluorescence (Rn) values were plotted depending on the signals from each well. Each well of the 96-well reaction plate is an individual point on the plot. Fluorescence detection and data analysis were carried out by 7500 Real-Time PCR instrument (Applied Biosystems) version 2.0.1.

Statistical analysis

Data were collected, tabulated, and statistically analyzed using an international business machine corporation personal computer with Statistical Package of Social Science (SPSS) version 22 (SPSS, Inc, Chicago, Illinois, USA). The following statistics were applied: a) Descriptive statistics: in which quantitative data were presented in the form of mean, Standard Deviation (SD), range, and qualitative data were presented in the form of numbers and percentages. b) Analytical statistics: was used to find out the possible association between studied factors and the targeted disease. The used tests of significance included: Chi-Square test (χ2),27 Student t-test (t),28 Mann-Whitney test (U),29 Kruskal Wallis test30; p-value of was considered significant if it was ≤ 0.05.

ResultsPersonal and clinical data of the investigated subjects

AA patients were 36 (48%) males and 39 (52%) females with a male: female ratio of 1:1.08. Their age ranged from 22 to 53 years with 32.4 ± 7.14 years as a mean ± SD value. Control subjects were 43 (57.3%) males and 32 (42.7%) females with a male: female ratio of 1.34:1. Their age ranged from 18 to 54 years with 32.7 ± 9.11 years as a mean ± SD value. There were non-statistically significant differences between cases and controls regarding their age (p = 0.956) and sex (p = 0.252). Table 1 demonstrates the clinical data of AA patients (n = 75).

Table 1.

Personal and clinical data of AA patients (n = 75).

Studied variables  NO%
AA patients 
(No = 75) 
Gender     
Male  36  48 
Female  39  52 
Age / years 
Mean ± SD  32.4 ± 7.14
Median  31.0
Range  22.0 – 53.0
Onset     
Sudden  95  78.7 
Gradual  16  21.3 
Course of the disease     
Progressive  44  58.7 
Stationary  31  41.3 
Duration / months 
Mean ± SD  11.3 ± 6.80
Median  10.0
Range  2.00 – 36.0
Family history     
Positive  12.0 
Negative  66  88.0 
Type of alopecia     
Patchy  71  94.7 
Totalis  4.00 
Ophiasis  1.30 
Associations     
Anxiety  53  70.7 
Depression  8.00 
Atopy  1.30 
No  15  20.0 
Nail changes     
Beau line  4.00 
Nail bitting  5.30 
Nail ridding  4.00 
Punctuate leukonychia  4.00 
Trachyonychia  2.70 
No  60  80.0 
SALT score 
Mean ± SD  17.2 ± 31.9
Median  1.80
Range  0.60 – 100.0

No, Number; %, Percentage; SD, Standard Deviation; AA, Alopecia Areata; SALT, Severity of Alopecia Areata Tool.

BMI, blood pressure and laboratory investigations of the studied subjects

There were non-significant differences between AA patients and controls regarding their BMI (p = 0.131), systolic blood pressure (p = 0.665), diastolic blood pressure (p = 0.304), fasting blood glucose (p = 0.171), triglycerides (p = 0.097) and low-density lipoprotein (p = 0.347). While there was a significant elevation in total cholesterol (p = 0.019) and a significant decrease in high-density lipoprotein (p = 0.001) (Table 2).

Table 2.

Comparison between AA patients and controls regarding their BMI, blood pressure and laboratory investigations (n = 150).

Studied variables  AA patients (No = 75)  Controls (No = 75)  Mann Whitney test  p-value 
BMI (kg/m2       
Mean ± SD  24.7 ± 3.96  22.3 ± 2.04     
Median  24.0  22.0  1.51  0.131 
Range  18.0 – 35.0  19.0 – 26.0     
Systolic blood pressure (mmHg)         
Mean ± SD  118.5 ± 10.0  118.4 ± 9.65     
Median  120.0  120.0  0.432  0.665 
Range  90.0 – 135.0  90.0 – 135.0     
Diastolic blood pressure (mmHg)         
Mean ± SD  80.9 ± 5.85  79.8 ± 5.60     
Median  80.0  80.0  1.02  0.304 
Range  60.0 – 90.0  60.0 – 90.0     
Fasting Blood Glucose (mg/dL)         
Mean ± SD  88.3 ± 8.22  91.6 ± 11.7     
Median  89.0  90.0  1.36  0.171 
Range  73.0 – 103.0  73.0 – 125.0     
Triglyceride (mg/dL)         
Mean ± SD  128.7 ± 13.9  123.4 ± 21.3     
Median  129.0  125.0  1.65  0.097 
Range  100.0 – 152.0  89.0 – 170.0     
Total cholesterol (mg/dL)         
Mean ± SD  149.8 ± 24.0  140.5 ± 22.4     
Median  150.5  140.0  2.34  0.019* 
Range  111.0 – 196.0  110.0 – 200.0     
HDLc (mg/dL)         
Mean ± SD  66.2 ± 4.15  73.7 ± 6.69     
Median  66.0  75.0  6.86  0.001* 
Range  60.0 – 77.0  60.0 – 88.0     
LDLc (mg/dL)         
Mean ± SD  87.8 ± 9.09  85.8 ± 10.6     
Median  90.0  87.0  0.941  0.347 
Range  69.0 – 102.0  47.0 – 104.0     

SD, Standard Deviation; U, Mann Whitney test; BMI, Body Mass Index; FBG, Fasting Blood Glucose; TG, Triglyceride; HDL, High Density Lipoprotein; DL, Low Density Lipoprotein; AA, Alopecia Areata.

Serum adiponectin levels and ADIPOQ (rs2241766) of the studied subjects

Serum adiponectin levels weresignificantly lower in AA patients than in controls (9.45 ± 4.12 vs. 13.8 ± 5.62 ng/mL) (p = 0.001) (Table 3).

Table 3.

Comparison between AA patients and controls regarding serum adiponectin levels and ADIPOQ (rs2241766) gene SNP.

Studied variables  AA patients (No = 75)Controls (No = 75)Test  p-value  OR (95% CI) 
Serum adiponectin levels (ng/mL)  Mann-Whitney     
Mean ± SD  9.45 ± 4.1213.8 ± 5.624.380.001
Median  9.6012.6
Range  2.80 – 15.36.89 ‒ 29.5
ADIPOQ (rs2241766) genotypes  No.  %  No.  %  χ2     
TT  44  58.7  66  88.0      Reference 5.17 (2.24 – 11.9)
TG  31  41.3  12.0  16.5  0.001 
Alleles  N = 150  %  N = 150  %  χ2     
T  119  79.3  141  94.0  13.90.001Reference 3.82 (1.75 – 8.35)
G  31  20.7  6.00 

AA, Alopecia Areata; No., Number; %, Percentage; χ2, Chi square test; OR, Odds Ratio; CI, Confidence interval.

Studying ADIPOQ (rs2241766) gene polymorphism showed that there was a significant difference between AA patients and controls. TG genotype was present in 31 (41.3%) AA patients versus 9 (12.0%) controls. The presence of TG genotype significantly increased the risk for AA by about 5 folds (OR = 5.17, p = 0.001). Also, Gallele significantly increases the risk for AA by about 4 folds (OR = 3.82, p = 0.001) (Table 3).

Adiponectin serum levels in relation to studied data of AA patients

There were non-significant relations between serum adiponectin level and the investigated data of AA patients except for the type of alopecia (significantly lower in alopecia totalis [p = 0.016]) and SALT score [a significant negative correlation (r = -0.435, p = 0.001) (Table 4). Serum adiponectin level was significantly lower in AA patients with TG genotype than in cases having TT genotype (5.33 ± 2.02 vs. 12.3 ± 2.34) (p = 0.001) (Fig. 1A).

Table 4.

Relation between serum adiponectin level and studied data of AA patients (n = 75).

Studied variablesSerum adiponectin  Test of significancep-value
Mean ± SD (ng/mL) 
Gender       
Male  9.07 ± 3.82  U  0.373 
Female  9.81 ± 4.39  0.891   
Onset       
Sudden  9.55 ± 4.12  0.605 
Gradual  9.11 ± 4.22  0.518   
Course of the disease       
Progressive  8.93 ± 4.70  U  0.287 
Stationary  10.2 ± 3.02  1.06   
Family history       
Positive  10.4 ± 3.75  0.546 
Negative  9.32 ± 4.17  0.603   
Type of alopecia       
Ophiasis  11.4 ± 0.00     
Patchy  9.69 ± 4.01  0.016* 
Totalis  3.10 ± 0.26  8.31   
Associations       
Anxiety  9.90 ± 3.68     
Depression  6.48 ± 4.98  0.088 
Atopy  3.40 ± 0.00  6.55   
Nail changes       
Beau line  13.8 ± 0.92     
Nail bitting  9.85 ± 6.28  0.229 
Nail ridding  11.2 ± 2.82  5.62   
Punctuate leukonychia  3.70 ± 0.51     
Trachyonychia  8.25 ± 4.45     
Age/years  r    p-value 
Age/years  0.183    0.115 
Disease duration/months  0.025    0.833 
BMI (kg/m20.110    0.348 
SBP (mmHg)  -0.080    0.497 
DBP (mmHg)  0.122    0.340 
Fasting Blood sugar (mg/dL)  0.171    0.143 
Triglyceride (mg/dL)  -0.085    0.471 
Total cholesterol (mg/dL)  0.143    0.220 
HDLc (mg/dL)  0.048    0.685 
LDLc (mg/dL)  -0.032    0.787 
SALT score  -0.435    0.001 

SD, Standard Deviation; K, Kruskal Wallis test; U, Mann Whitney test; *r, Spearman’s correlation; BMI, Body Mass Index; SBP, Systolic Blood Pressure; DBP, Diastolic Blood Pressure; HDL, High Density Lipoprotein; LDL, Low Density Lipoprotein; SALT, Severity of Alopecia Areata Tool.

Figure 1.

ADIPOQ (rs2241766) genotypes in relation to: (A) Serum adiponectin levels among the studied AA patients. (B) SALT score of studied AA patients.

(0.22MB).
Relationship between ADIPOQ (rs2241766) genotypes and studied data of AA patients

There were non-significant relationships between ADIPOQ (rs2241766) genotypes and any of the clinical data of studied AA patients except for the SALT score that was significantly higher in TG genotype carriers than TT carrier cases (p = 0.001) (Fig. 1B).

Discussion

In the current study, ADIPOQ (rs2241766) SNP was strongly related to adiponectin serum concentrations in AA patients, and associated with the disease severity. By this study, we have shownthat ADIPOQ (rs2241766) SNP could modulate AA risk and contribute to the development of AA in Egyptian populations that had not previously been identified, and we confirmed that decreased circulating adiponectin levels may have an active role in AA etiopathogenesis. Confirmatory studies are necessary to make sure that the observed associations are true rather than spurious.

Metabolism and the immune system are connected via a network of numerous soluble mediators known as adipokines. These adipokines are regarded as bad and good adipokines. Bad adipokines are pro-inflammatory and produce insulin resistance, vascular dysfunction, and local inflammatory reactions that support cutaneous inflammation. On the other hand, good adipokines have opposed properties.31

Here in, we considered adiponectin as a good adipokine. We found a significant decrease in its circulating levels in AA patients than controls, and this low concentration was more observed with more severe disease and in alopecia totalis cases.

Confirming these observations, Stochmal et al.17 demonstrated a significant decrease in adiponectin serum levels in AA patients than their matched peers. They also reported that adiponectin serum level was negatively correlated with SALT score and had its lowest concentration in patients with alopecia universalis. The decreased levels of serum adiponectin were also described in patients with Sjogren’s syndrome, psoriatic arthritis, and multiple sclerosis.32

Adiponectin, a serum protein, is produced mostly by adipocytes. But, other cells such as the fibroblasts, endothelial cells, macrophages, and leukocytes also may synthesize adiponectin.33 Adiponectin consumes an anti-inflammatory influence. It reduces B-cell lymphopoiesis and T-cell responsiveness, as well as TNF-α synthesis. It also stimulates IL-10 production.32

AA pathogenesis is not completely assumed. It appears that immune system activation is considered one of the main biological processes connected to the pathogenesis of AA.34 In AA the unusual levels of many pro-inflammatory cytokines e.g. IL-6 and TNF-α and anti-inflammatory ones as IL-10 were confirmed.35,36 It appears that cytokine production disequilibrium, with a relative excess of pro-inflammatory versus low anti-inflammatory cytokines, could have an active role in AA development.37

TNF-α is a normal in vitro inhibitor of hair follicle growth. TNF-α, together with IL-1α and -β, induces matrix cell vacuolation within the bulb of the hair follicle and decreases the matrix size. It also disorganizes the follicular melanocytes and induces abnormal differentiation in the inner root sheath and precortical cells.38 It was reported that TNF-α serum39 and tissue38 levels in patients with AA were significantly higher than controls.

Thus, we hypothesized that in AA, adiponectin could act as an anti-inflammatory molecule, and the current demonstrated low adiponectin serum levels in AA patients may be translated into a repressed anti-inflammatory activity. Impaired adiponectin levels may influence numerous processes within the hair follicle environment leading to local autoimmune response resulting in exacerbated hair loss.

However, Serarslan et al.16 did not show significant differences in adiponectin concentration in patients with AA compared to healthy controls. Moreover, we showed higher serum levels of adiponectin in patients with scalp hair loss compared to those with isolated AA in the beard and eyebrow. The authors said that their result was an unexpected finding. They added that, as in RA, where adiponectin serum and synovial levels were increased, adiponectin is suggested to increase the production of inflammatory mediators.40 These controversial results need more similar large-scale studies to verify.

In the present work we analyzed, for the first time, ADIPOQ (rs2241766) SNP in AA patients, and correlated its genotypes with the AA severity, site, progression, and disease duration as well as with adiponectin serum level. We found that the TG genotype was significantly present in AA patients increasing its risk by about 5 folds, and the G allele significantly increased the risk by about 4 folds. Moreover, ADIPOQ (rs2241766)TG genotype carriers demonstrated significantly low adiponectin serum levels and a severe form of AA. Therefore, we suggested that ADIPOQ (rs2241766) gene polymorphism contributes not only to the development of AA, but also to its severity, that is mediated through dysregulation of adiponectin transcription.

Supporting these results, Saleh et al.41 revealed that ADIPOQ (rs2241766) mutant alleles were linked to diminished circulatory adiponectin levels in cases having myocardial infarctions. Furthermore, Al-Shaheri et al.22 found that ADIPOQrs2241766 and rs3774261 SNPs increase the risk of atopic dermatitis. Previously, Wassel et al.42 reported that adiponectin SNPs rs17300539, rs182052, rs822393, rs9882205, and rs3774261 were strongly associated with adiponectin serum concentrations in whites.

The study limitations were: a) The small sample size, b) The study is structurally a case-control one, and c) The authors evaluated only a single adipokine rather than multiple ones.

Conclusion

It seems that ADIPOQ (rs2241766) gene polymorphism (TG genotype and G allele) may modulate AA risk and contribute to the development of AA in Egyptian populations. Decreased circulating adiponectin levels may have a dynamic role in AA etiopathogenesis that could possibly be mediated via its anti-inflammatory effects. Adiponectin serum concentration can be considered a severity marker of hair loss in AA.

Financial support

None declared.

Authors’ contributions

Azza Gaber Antar Farag: Critical literature review; study conception and planning.

Eman Abd-Elfatah Badr labeeb: Data analysis and interpretation.

Banan Mohamed Gamal Abd-Elaty: Data collection

Nada Farag Elnaidany: Statistical analysis.

Mai Medhat Mohamed Ghanem: Data analysis and interpretation.

Conflicts of interest

None declared.

Acknowledgment

All authors are grateful to the Dermatology and Biochemistry Department technical and administrative staff at the Faculty of Medicine- Menoufia University who helped kindly throughout this work.

References
[1]
C. Zhou, X. Li, C. Wang, J. Zhang.
Alopecia areata: an update on etiopathogenesis, diagnosis, and management.
Clin Rev Allergy Immunol., 61 (2021), pp. 403-423
[2]
P. Suchonwanit, C. Kositkuljorn, C. Pomsoong.
Alopecia areata: an autoimmune disease of multiple players.
Immunotargets Ther., 29 (2021), pp. 299-312
[3]
A. Waśkiel, A. Rakowska, M. Sikora, M. Olszewska, L. Rudnicka.
Trichoscopy of alopecia areata: an update.
J Dermatol., 45 (2018), pp. 692-700
[4]
T. Simakou, J.P. Butcher, S. Reid, F.L. Henriquez.
Alopecia areata: a multifactorial autoimmune condition.
J Autoimmun., 98 (2019), pp. 74-85
[5]
R.Z. Conic, N.L. Tamashunas, G. Damiani, G. Fabbrocini, M. Cantelli, Young Dermatologists Italian Network, et al.
Comorbidities in pediatric alopecia areata.
J Eur Acad Dermatol Venereol., 34 (2020), pp. 2898-2901
[6]
G. Fantuzzi.
Adipose tissue, adipokines, and inflammation.
J Allergy Clin Immunol., 115 (2005), pp. 911-919
[7]
M. Ruiz, M. Ståhlman, J. Borén, M. Pilon.
AdipoR1 and AdipoR2 maintain membrane fluidity in most human cell types and independently of adiponectin.
J Lipid Res., 60 (2019), pp. 995-1004
[8]
R. Polito, E. Nigro, A. Messina, M.L. Monaco, V. Monda, O. Scudiero, et al.
Adiponectin and Orexin-A as a potential immunity link between adipose tissue and central nervous system.
Front Physiol., 9 (2018), pp. 982
[9]
Y.L. Chen, J. Tao, P.J. Zhao, W. Tang, J.P. Xu, K.Q. Zhang, et al.
Adiponectin receptor PAQR-2 signaling senses low temperature to promote C. elegans longevity by regulating autophagy.
Nat Commun., 10 (2019), pp. 2602
[10]
F. Bai, W. Zheng, Y. Dong, J. Wang, M.A. Garstka, R. Li, et al.
Serum levels of adipokines and cytokines in psoriasis patients: a systematic review and meta-analysis.
Oncotarget., 9 (2017), pp. 1266-1278
[11]
I. Bulur, H.K. Erdogan, E. Kocatürk, Z.N. Saracoglu, Ö. Alataş, P. Yildiz, et al.
The role of irisin in the relationship between psoriasis and insulin resistance.
G Ital Dermatol Venereol., 153 (2018), pp. 477-482
[12]
A.A. Çerman, E. Aktaş, İK. Altunay, J.E. Arıcı, A. Tulunay, F.Y. Ozturk.
Dietary glycemic factors, insulin resistance, and adiponectin levels in acne vulgaris.
J Am Acad Dermatol., 75 (2016), pp. 155-162
[13]
K. Aydin, F. Çetinözman, G. Elcin, D.Y. Aksoy, F. Ucar, B.O. Yildiz.
Suppressed adiponectin levels and increased adiponectin response to oral glucose load in lean women with severe acne normalizes after isotretinoin treatment.
Dermatology., 233 (2017), pp. 314-319
[14]
H.C. Chang, M.H. Lin, Y.C. Huang.
Association between circulating adipokines and acne vulgaris: a systematic review and meta-analysis.
Australas J Dermatol., 60 (2019), pp. e361-4
[15]
A.K. Jaworek, J.C. Szepietowski, K. Szafraniec, M. Jaworek, P. Hałubiec, A. Wojas-Pelc, et al.
Adipokines as biomarkers of atopic dermatitis in adults.
J Clin Med., 9 (2020), pp. 2858
[16]
G. Serarslan, O. Özcan, E. Okyay, B. Ünlü, M. Karadağ.
Role of adiponectin and leptin in patients with alopecia areata with scalp hair loss.
Ir J Med Sci., 190 (2021), pp. 1015-1020
[17]
A. Stochmal, A. Waśkiel-Burnat, S. Chrostowska, M. Zaremba, A. Rakowska, J. Czuwara, et al.
Adiponectin as a novel biomarker of disease severity in alopecia areata.
Sci Rep., 11 (2021), pp. 13809
[18]
J. Yu, L. Liu, Z. Li, Y. Wang, W. Zhang, Y. Jin, et al.
Association of single nucleotide polymorphisms in ADIPOQ gene with risk of hypertension: a systematic review and meta-analysis.
Int J Mol Epidemiol Genet., 12 (2021), pp. 90-101
[19]
M. Garba, O.F. Khabour, K.H. Alzoubi, A. Abu-Siniyeh, F. Al-Qarqaz.
The association between adiponectin single nucleotide polymorphisms and side effects of isotretinoin in acne patients.
Dermatol Res Pract., 2020 (2020),
[20]
K. Shimada, T. Miyazaki, H. Daida.
Adiponectin and atherosclerotic disease.
Clin Chim Acta., 344 (2004), pp. 1-12
[21]
Y.L. Zhao, T.P. Zhang, J. Wu, B.Z. Li, X.M. Li, H.F. Pan, et al.
Association of adiponectin and adiponectin receptor gene polymorphisms with rheumatoid arthritis in a Chinese population.
Postgrad Med J., 96 (2020), pp. 149-155
[22]
F. Al-Shaheri, O.F. Khabour.
Associations between rs2241766 and rs3774261 polymorphisms in ADIPOQ gene and atopic dermatitis.
Acta Biochim Pol., 69 (2022), pp. 637-677
[23]
A.R. Setty, G. Curhan, H.K. Choi.
Obesity, waist circumference, weight change, and the risk of psoriasis in women: nurses’ Health Study II.
Arch Intern Med., 167 (2007), pp. 1670-1675
[24]
E.A. Olsen, M.K. Hordinsky, V.H. Price, J.L. Roberts, J. Shapiro, D. Canfield, et al.
Alopecia areata investigational assessment guidelines--Part II. National Alopecia Areata Foundation.
J Am Acad Dermatol., 51 (2004), pp. 440-447
[25]
E. Burtis, M. Santos-Rosa, J. Bienvenu, J. Whicher.
Role of the clinical laboratory in diabetes mellitus.
Tietz Textbook of Clinical Chemistry, 4th ed, Mosby, (2006), pp. 837-903
[26]
A. Ghasemi, S. Asgari, F. Hadaegh, M. Kheirandish, I. Azimzadeh, F. Azizi, et al.
New modified Friedewald formulae for estimating low-density lipoprotein cholesterol according to triglyceride levels: extraction and validation.
Endocrine., 62 (2018), pp. 404-411
[27]
N. Pandis.
The chi-square test.
Am J Orthod Dentofacial Orthop., 150 (2016), pp. 898-899
[28]
J.C.F. De Winter.
Using the Student’s t-test with extremely small sample sizes.
Pract Assess Res Eval., 18 (2013), pp. 10
[29]
P.E. McKnight, J. Najab.
Mann-Whitney U Test.
Corsini Encyclopedia Psychol., 30 (2010), pp. 1
[30]
E. Ostertagova, O. Ostertag, J. Kováč.
Methodology and application of the Kruskal-Wallis test.
Appl Mech Mater., 611 (2014), pp. 115-120
[31]
A.G. Farag, R.A. Hassan, S.E. Solomon, M.A. Mohamed.
Serum level of apelin-36 in psoriatic patients.
Menoufia Med., 34 (2016), pp. 926
[32]
J. Hutcheson.
Adipokines influence the inflammatory balance in autoimmunity.
Cytokine., 75 (2015), pp. 272-279
[33]
J. Żółkiewicz, A. Stochmal, L. Rudnicka.
The role of adipokines in systemic sclerosis: a missing link?.
Arch Dermatol Res., 311 (2019), pp. 251-263
[34]
S. Torkestani, H. Moghimi, R. Farsiabi, S. Khazaei, M.M. Eftekharian, E. Dalvand.
Evaluation of serum levels of IL-6, IL-10, and TNF-alpha in alopecia areata patients: a systematic review and meta-analysis.
Biomed Res Ther., 8 (2021), pp. 4668-4678
[35]
O. Bilgic, A. Sivrikaya, A. Unlu, H.C. Altinyazar.
Serum cytokine and chemokine profiles in patients with alopecia areata.
J Dermatolog Treat., 27 (2016), pp. 260-263
[36]
R.K. Gautam, Y. Singh, A. Gupta, P. Arora, A. Khurana, A. Chitkara.
The profile of cytokines (IL-2, IFN-γ, IL-4, IL-10, IL-17A, and IL-23) in active alopecia areata.
J Cosmet Dermatol., 19 (2020), pp. 234-240
[37]
C. Bodemer, M. Peuchmaur, S. Fraitaig, L. Chatenoud, N. Brousse, Y. De Prost.
Role of cytotoxic T cells in chronic alopecia areata.
J Invest Dermatol., 114 (2000), pp. 112-116
[38]
Y.M. Gohary, D.S. Abdel Fattah.
Detection of tumor necrosis factor-alpha in nonlesional tissues of alopecia areata patients: a prove for a systemic disease.
Int J Trichology., 9 (2017), pp. 154-159
[39]
A. Koubanova, A. Gadjlgoroeva.
On the problem of pathogenetic heterogeneity of alopecia areata.
EHRS Brussels, Conference abstracts, pp. 13
[40]
M. Otero, R. Lago, R. Gomez, F. Lago, C. Dieguez, J.J. Gómez-Reino, et al.
Changes in plasma levels of fat-derived hormones adiponectin, leptin, resistin and visfatin in patients with rheumatoid arthritis.
Ann Rheum Dis., 65 (2006), pp. 1198-1201
[41]
A.A. Saleh, S.I. Tayel, A.G. Shalaby, S.S. El Naidany.
Role of adiponectin gene and receptor polymorphisms and their mRNA levels with serum adiponectin level in myocardial infarction.
Appl Clin Genet., 13 (2020), pp. 241-252
[42]
C.L. Wassel, J.S. Pankow, D.R. Jacobs Jr., M.W. Steffes, N. Li, P.J. Schreiner.
Variants in the adiponectin gene and serum adiponectin: the coronary artery development in young adults (CARDIA) study.
Obesity (Silver Spring)., 18 (2010), pp. 2333-2338

Study conducted at the Dermatology, Andrology and STDs Department, and Medical Biochemistry and Molecular Biology Department, Faculty of Medicine, Menoufia University, Egypt.

Copyright © 2023. Sociedade Brasileira de Dermatologia
Download PDF
Idiomas
Anais Brasileiros de Dermatologia
Article options
Tools
en pt
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.