array:23 [
  "pii" => "S0365059623000661"
  "issn" => "03650596"
  "doi" => "10.1016/j.abd.2022.07.007"
  "estado" => "S300"
  "fechaPublicacion" => "2023-07-01"
  "aid" => "747"
  "copyright" => "Sociedade Brasileira de Dermatologia"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "pt" => array:18 [
      "pii" => "S2666275223000942"
      "issn" => "26662752"
      "doi" => "10.1016/j.abdp.2023.03.025"
      "estado" => "S300"
      "fechaPublicacion" => "2023-07-01"
      "aid" => "747"
      "copyright" => "Sociedade Brasileira de Dermatologia"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "pt" => array:12 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Artigo original</span>"
        "titulo" => "Detec&#231;&#227;o do DNA de <span class="elsevierStyleItalic">Bartonella henselae</span> no sangue de pacientes com vasculopatia livedoide"
        "tienePdf" => "pt"
        "tieneTextoCompleto" => "pt"
        "tieneResumen" => "pt"
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "472"
            "paginaFinal" => "479"
          ]
        ]
        "contieneResumen" => array:1 [
          "pt" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "pt" => true
        ]
        "contienePdf" => array:1 [
          "pt" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0015"
            "etiqueta" => "Figura 3"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr3.jpeg"
                "Alto" => 1659
                "Ancho" => 2508
                "Tamanyo" => 1105933
              ]
            ]
            "descripcion" => array:1 [
              "pt" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">&#218;lcera cr&#244;nica&#58; &#40;A&#41; epiderme hiperpl&#225;sica na borda &#40;seta vermelha&#41;&#44; vasos com paredes hialinizadas na borda e no leito da &#250;lcera &#40;setas pretas&#41;&#44; agregados de c&#233;lulas inflamat&#243;rias e fibrose da derme reticular e hipoderme&#59; &#40;B&#41; hialinose da parede e trombose oclusiva da luz dos vasos da derme e hipoderme &#40;setas amarelas&#41;&#44; com exsudato inflamat&#243;rio contendo neutr&#243;filos polimorfonucleares&#46; Hematoxilina&#8208;eosina&#44; x40 &#40;A&#41; e x100 &#40;B&#41;&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Marina Rovani Drummond, Luciene Silva dos Santos, Lais Bomediano Souza, Gabriela Nero Mitsuushi, Maria Let&#237;cia Cintra, Andrea Fernandes Eloy da Costa Fran&#231;a, Elemir Macedo de Souza, Paulo Eduardo Neves Ferreira Velho"
            "autores" => array:8 [
              0 => array:2 [
                "nombre" => "Marina Rovani"
                "apellidos" => "Drummond"
              ]
              1 => array:2 [
                "nombre" => "Luciene Silva dos"
                "apellidos" => "Santos"
              ]
              2 => array:2 [
                "nombre" => "Lais Bomediano"
                "apellidos" => "Souza"
              ]
              3 => array:2 [
                "nombre" => "Gabriela Nero"
                "apellidos" => "Mitsuushi"
              ]
              4 => array:2 [
                "nombre" => "Maria Let&#237;cia"
                "apellidos" => "Cintra"
              ]
              5 => array:2 [
                "nombre" => "Andrea Fernandes Eloy da Costa"
                "apellidos" => "Fran&#231;a"
              ]
              6 => array:2 [
                "nombre" => "Elemir Macedo de"
                "apellidos" => "Souza"
              ]
              7 => array:2 [
                "nombre" => "Paulo Eduardo Neves Ferreira"
                "apellidos" => "Velho"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "pt"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S0365059623000661"
          "doi" => "10.1016/j.abd.2022.07.007"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623000661?idApp=UINPBA00008Z"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223000942?idApp=UINPBA00008Z"
      "url" => "/26662752/0000009800000004/v2_202307101646/S2666275223000942/v2_202307101646/pt/main.assets"
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S036505962300048X"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2022.02.008"
    "estado" => "S300"
    "fechaPublicacion" => "2023-07-01"
    "aid" => "729"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Immunohistochemical detection of <span class="elsevierStyleItalic">Treponema pallidum</span> in skin samples with clinical and histopathological correlations and Warthin-Starry staining critical analysis"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "480"
          "paginaFinal" => "486"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1193
              "Ancho" => 3341
              "Tamanyo" => 532036
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0085"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; Basal cell layer background staining &#40;Warthin-Starry staining&#44; &#215;1000&#41;&#46; &#40;B&#41; Unspecified structures in dermis &#40;arrows&#44; Warthin-Starry staining&#44; &#215;1000&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Mariana Freitas de Assis Pereira Rosa, Leonardo Pereira Quintella, Luiz Claudio Ferreira, Tullia Cuzzi"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Mariana Freitas de Assis Pereira"
              "apellidos" => "Rosa"
            ]
            1 => array:2 [
              "nombre" => "Leonardo Pereira"
              "apellidos" => "Quintella"
            ]
            2 => array:2 [
              "nombre" => "Luiz Claudio"
              "apellidos" => "Ferreira"
            ]
            3 => array:2 [
              "nombre" => "Tullia"
              "apellidos" => "Cuzzi"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275223000565"
        "doi" => "10.1016/j.abdp.2023.03.006"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223000565?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S036505962300048X?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000004/v1_202307031010/S036505962300048X/v1_202307031010/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S0365059623000569"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2022.09.007"
    "estado" => "S300"
    "fechaPublicacion" => "2023-07-01"
    "aid" => "737"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Cutaneous manifestations of COVID-19 patients in a Hospital in S&#227;o Paulo&#44; Brazil&#44; and global literature review"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "466"
          "paginaFinal" => "471"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1474
              "Ancho" => 1508
              "Tamanyo" => 236729
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0005"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Erythematous rash containing macules and papules&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Silmara da Costa Pereira Cestari, Marcela da Costa Pereira Cestari, Gabriela Franco Marques, Ivana Lirio, Reinaldo Tovo, Ilana Cruz Silva Labriola"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Silmara da Costa Pereira"
              "apellidos" => "Cestari"
            ]
            1 => array:2 [
              "nombre" => "Marcela da Costa Pereira"
              "apellidos" => "Cestari"
            ]
            2 => array:2 [
              "nombre" => "Gabriela Franco"
              "apellidos" => "Marques"
            ]
            3 => array:2 [
              "nombre" => "Ivana"
              "apellidos" => "Lirio"
            ]
            4 => array:2 [
              "nombre" => "Reinaldo"
              "apellidos" => "Tovo"
            ]
            5 => array:2 [
              "nombre" => "Ilana"
              "apellidos" => "Cruz Silva Labriola"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275223000838"
        "doi" => "10.1016/j.abdp.2023.03.015"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223000838?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623000569?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000004/v1_202307031010/S0365059623000569/v1_202307031010/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Detection of <span class="elsevierStyleItalic">Bartonella henselae</span> DNA in the blood of patients with livedoid vasculopathy"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "472"
        "paginaFinal" => "479"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Marina Rovani Drummond, Luciene Silva dos Santos, Lais Bomediano Souza, Gabriela Nero Mitsuushi, Maria Let&#237;cia Cintra, Andrea Fernandes Eloy da Costa Fran&#231;a, Elemir Macedo de Souza, Paulo Eduardo Neves Ferreira Velho"
        "autores" => array:8 [
          0 => array:4 [
            "nombre" => "Marina Rovani"
            "apellidos" => "Drummond"
            "email" => array:1 [
              0 => "mrovani@unicamp.br"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Luciene Silva dos"
            "apellidos" => "Santos"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Lais Bomediano"
            "apellidos" => "Souza"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Gabriela Nero"
            "apellidos" => "Mitsuushi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Maria Let&#237;cia"
            "apellidos" => "Cintra"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Andrea Fernandes Eloy da Costa"
            "apellidos" => "Fran&#231;a"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Elemir Macedo de"
            "apellidos" => "Souza"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Paulo Eduardo Neves Ferreira"
            "apellidos" => "Velho"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Department of Clinical Medicine&#44; School of Medical Sciences&#44; Universidade Estadual de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Laboratory of Applied Research in Dermatology and Bartonella Infection&#44; School of Medical Sciences&#44; Universidade Estadual de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Medicine&#44; Pontif&#237;cia Universidade Cat&#243;lica de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Department of Pathological Anatomy&#44; School of Medical Sciences&#44; Universidade Estadual de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1659
            "Ancho" => 2508
            "Tamanyo" => 1105933
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Chronic ulcer&#58; &#40;A&#41; hyperplastic epidermis at the edge &#40;red arrow&#41;&#44; vessels with hyalinized walls at the edge and in the ulcer bed &#40;black arrows&#41;&#44; inflammatory cell aggregates and fibrosis of the reticular dermis and hypodermis&#59; &#40;B&#41; wall hyalinosis and occlusive thrombosis of the lumen in the dermis and hypodermis vessels &#40;yellow arrows&#41;&#44; with inflammatory exudate containing polymorphonuclear neutrophils&#46; Hematoxylin &#38; eosin&#44; x40 &#40;A&#41; and x100 &#40;B&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Livedoid vasculopathy &#40;LV&#41; manifests as painful ulcers located distally on the lower limbs&#44; which slowly develop into whitish atrophic lesions&#44; with punctate telangiectasias&#44; brownish pigmentation&#44; accompanied by livedo racemosa&#46; The most often accepted LV etiopathogenesis comprises vaso-occlusive phenomena resulting from hypercoagulable states&#46; Conditions such as thrombophilia&#44; diffuse connective tissue diseases &#44; myeloproliferative disorders&#44; and blood stasis are known to be associated with the disease&#44; but the idiopathic &#40;primary&#41; form is the predominant one&#46;<a class="elsevierStyleCrossRefs" href="#bib0005"><span class="elsevierStyleSup">1&#44;2</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">This study was carried out based on the clinical observation of a 41-year-old patient&#44; with a history of contact with cats and who had ulcerated lesions on the lower limbs that were difficult to control for 12 years &#40;<a class="elsevierStyleCrossRefs" href="#fig0005">Figs&#46; 1 and 2</a>&#41;&#46; Histopathology showed hypodermitis associated with leukocytoclastic vasculitis and the presence of frequent hyaline thrombi&#44; with fibrinoid necrosis of small vessel walls&#46; Mucin and hemosiderin deposits were also observed&#44; in addition to vascular proliferation &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; After excluding other diseases&#44; the patient was managed as a case of primary LV and treated over the years with vasodilators&#44; antiplatelet agents&#44; corticosteroids&#44; and cycles of antibiotics &#40;metronidazole&#44; penicillin&#44; and ciprofloxacin&#41;&#44; with transient improvement&#46; Considering the strong epidemiology of contact with cats&#44; screening for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; was suggested&#46; <span class="elsevierStyleItalic">Bartonella henselae</span> DNA was detected by polymerase chain reaction &#40;PCR&#41; in the patient&#39;s blood and there was a prompt improvement of the chronic ulcers with treatment of the <span class="elsevierStyleItalic">B&#46; henselae</span> infection with doxycycline 200&#160;mg&#47;day for one year&#46; After treatment withdrawal&#44; however&#44; the LV lesions recurred&#46; The bacterium was isolated and its DNA was once again detected in a new blood sample &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0015" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Bartonella</span> spp&#46; are fastidious bacteria and&#44; therefore&#44; difficult to isolate&#46; Although distributed worldwide&#44; they are neglected and life-threatening microorganisms that often live inside erythrocytes and endothelial cells&#46; Infection by these bacteria can be asymptomatic&#44; but can also cause a variety of clinical conditions in humans&#44; including fever of unknown origin&#44; endocarditis&#44; and cat-scratch disease&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> Cutaneous manifestations also vary and include leukocytoclastic vasculitis and ulcers&#44; as reviewed by Lins et al&#46; in a recent review of the cutaneous manifestations of bartonellosis published in this journal&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> The main objective of the present study was to investigate the presence of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in patients with primary LV with difficult-to-control ulcers&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Methods</span><p id="par0020" class="elsevierStylePara elsevierViewall">A free and informed consent form was obtained from each participant after evaluation and authorization provided by the UNICAMP Institutional Research Board &#40;CAAE&#58; 48163015&#46;8&#46;0000&#46;5405&#41;&#46; Patients over 18 years of age&#44; with a diagnosis of primary LV undergoing follow-up at UNICAMP Dermatology Outpatient Clinic were included in the study&#44; and volunteers without clinical complaints were included as a control group &#40;UNICAMP students and&#47;or employees&#44; over 18 years of age and not pregnant&#41;&#46; Each participant answered a questionnaire to assess risk exposure for acquiring <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#46; Blood samples were collected from the patients and control individuals using an aseptic technique in tubes containing ethylenediaminetetraacetic acid &#40;EDTA&#41; and in tubes without anticoagulant&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">The laboratory where the analyses were performed follows standards to ensure the quality control described by Pitassi et al&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> Liquid cultures of blood and blood clot samples &#40;blood clots collected from the tube without anticoagulant&#41; and solid cultures of all liquid cultures were performed as previously described&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#44;7</span></a> DNA was extracted from blood samples&#44; from blood clots&#44; and from the liquid cultures using QIAamp DNA minikit &#40;Qiagen Inc&#46;&#44; USA&#41;&#46; In addition to conventional PCR for the constitutive mammalian gene&#44; GAPDH&#44; genus-specific conventional PCR for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; and species-specific double-amplification &#40;nested&#41; and real-time PCRs for <span class="elsevierStyleItalic">B&#46; henselae</span> were performed&#46; Three controls were added in all procedures&#44; &#40;extraction negative control&#44; PCR-negative control and PCR-positive control &#8210; strain 3715 of <span class="elsevierStyleItalic">B&#46; henselae</span> registered in the Culture Collection Section of Instituto Adolfo Lutz&#41;&#46; Additionally&#44; dilutions of <span class="elsevierStyleItalic">B&#46; henselae</span> were tested in each reaction to determine the sensitivity and the limit of detection of each PCR&#46; All of these methods have been previously described&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#8211;11</span></a> The primers used in the molecular investigation of patients and volunteers are described in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; The obtained amplifications that showed adequate quality for sequencing were sent for similarity comparison with previously deposited material&#46; The flowchart of the performed procedures is shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Results</span><p id="par0030" class="elsevierStylePara elsevierViewall">Sixteen patients with primary LV and 32 individuals without clinical complaints participated in the study&#46; All answered a questionnaire whose data are shown in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#46; It can be observed that the control group was younger &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;001&#41;&#44; with a mean age of 26&#46;71 years&#44; whereas the mean age was 37&#46;62 years among the patients&#46; The control group had more men than the patient group &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;048&#41;&#46; Individuals in this group had more contact with pets &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;007&#41;&#44; were more bitten and&#47;or scratched &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;000&#41;&#44; and were more exposed to arthropods &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;003&#41;&#46; There was no significant difference &#40;<span class="elsevierStyleItalic">p</span>&#160;&#62;&#160;0&#46;05&#41; when comparing these characteristics in those who had <span class="elsevierStyleItalic">Bartonella</span> spp&#46; DNA detected and those who did not&#44; in each of the groups separately&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">The constitutive gene &#40;GAPDH&#41; was detected in all samples from patients and volunteers&#44; guaranteeing the quality of the DNA extracted for the analyses and the absence of inhibitors for the reactions&#44; guaranteeing the quality of the DNA extracted from the samples and the absence of inhibitors for the molecular reactions&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall">In conventional PCR for <span class="elsevierStyleItalic">Bartonella</span> spp&#46;<span class="elsevierStyleItalic">&#44;</span> the limit of detection was 50 genome equivalent &#40;GE&#41; and ten GE in the nested PCR and real-time PCR&#46;</p><p id="par0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">B&#46; henselae</span> DNA was detected in four patients in at least one species-specific reaction&#46; In the control group&#44; DNA was detected in four volunteers&#46; Amplified material from six participants out of eight with bacterial DNA detection was sequenced&#44; and all amplified samples showed 99&#37; to 100&#37; of similarity to <span class="elsevierStyleItalic">B&#46; henselae</span> &#40;GenBank accession number&#58; CP020742&#46;1&#41;&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">There was no growth of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in solid cultures from any sample of the 48 participants&#46; There was no statistical significance using Fischer&#8217;s test in the detection of bacterial DNA between the two groups &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;413&#41;&#44; as also observed in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">Considering that primary LV is a rare manifestation and using Fisher&#39;s exact test to establish the sample size calculation for the study and setting the significance level at 5&#37; &#40;alpha or type I error&#41; with a sampling power of 80&#37; &#40;beta or type II error of 20&#37;&#41;&#44; based on the obtained data&#44; it can be established that the minimum sample size for the results to have statistical significance would be 106 patients&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Discussion</span><p id="par0060" class="elsevierStylePara elsevierViewall">The authors did not find any studies in the literature reporting infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in LV&#46; As it has been proposed for SARS-CoV-2&#44;<a class="elsevierStyleCrossRef" href="#bib0060"><span class="elsevierStyleSup">12</span></a> it is possible that persistent infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; also causes direct vascular damage or promotes a hypercoagulable state&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">It is known that LV is a vaso-occlusive disease with hyalinization and thrombosis of dermal vessels&#44; and many patients complain of pain and paresthesia&#46; All studied patients reported severe pain associated with the presence of ulcers&#44; and most reported paresthesia or mild pain after healing&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> Several articles have associated chronic pain with <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#46;<a class="elsevierStyleCrossRefs" href="#bib0065"><span class="elsevierStyleSup">13&#8211;15</span></a> Translational studies have documented pain hypersensitivity in mice infected with <span class="elsevierStyleItalic">B&#46; henselae</span>&#46;<a class="elsevierStyleCrossRefs" href="#bib0080"><span class="elsevierStyleSup">16&#44;17</span></a> These microorganisms cause intra-endothelial infection and could stimulate endothelin &#40;ET-1&#41; synthesis&#44; a potent vasoconstrictor&#44; which is related to paresthesia and pain&#44; including chronic pain&#46;<a class="elsevierStyleCrossRefs" href="#bib0065"><span class="elsevierStyleSup">13&#44;16&#44;18&#44;19</span></a></p><p id="par0070" class="elsevierStylePara elsevierViewall">It was not possible to detect the DNA of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in three-quarters of the patients&#44; which is not surprising&#44; since LV is a cutaneous manifestation of different diseases&#46; Moreover&#44; <span class="elsevierStyleItalic">B&#46; henselae</span> causes cyclic bacteremia&#44; and the blood samples can be obtained at intervals when the bacteria are not circulating&#46; Different authors have shown that infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; has a greater chance of being diagnosed through a biopsy of tissue fragments than by a blood sample and that the results of this difference may be of greater importance and show statistical significance&#46;<a class="elsevierStyleCrossRefs" href="#bib0095"><span class="elsevierStyleSup">19&#8211;23</span></a> For ethical reasons&#44; only blood samples were collected to minimize damage to the control group volunteers&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">Furthermore&#44; there is no reference diagnostic method for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection and false-negative results are frequent&#44; even when using a platform with molecular and microbiological techniques&#46; The need for multiple tests for adequate detection of this microorganism&#44; aiming at reducing false negative results&#44; has already been discussed by Drummond et al&#46; Molecular techniques are limited by their low sensitivity &#40;minimum of 4&#44;000 copies&#47;mL in the laboratory where the analyses were performed&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Even in diseases with tissue involvement&#44; the identification of the agent in the anatomopathological examination has low sensitivity&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> Historically&#44; silver impregnation stains have been used for the detection of <span class="elsevierStyleItalic">Bartonella</span> species&#59; however&#44; as the stain is non-specific&#44; the reading can be difficult due to the formation of silver precipitates&#46; A study by Caponetti et al&#46; evaluated the use of immunohistochemistry &#40;IHC&#41; for the identification of <span class="elsevierStyleItalic">B&#46; henselae</span> in cat-scratch disease &#40;CSD&#41; in 24 cases of lymphadenitis in formalin-fixed and paraffin-embedded biopsy specimens and compared the results with silver impregnation &#40;SI&#41; and PCR&#46; The positive cases were as follows&#58; SI&#44; 11 &#40;46&#37;&#41;&#59; PCR&#44; nine &#40;38&#37;&#41;&#59; and IHC&#44; six &#40;25&#37;&#41;&#46; Only two cases &#40;8&#37;&#41; were positive for all three studies and SI was more sensitive but less specific&#46; Although 11 &#40;46&#37;&#41; of the study cases were positive using SI&#44; only six of these samples were concurrently positive at the immunohistochemical analysis and&#47;or PCR&#46; This finding suggests that several of the cases interpreted as positive by SI may represent false-positive results and that the diagnostic sensitivity of these three tests is low for CSD&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a> Another study with 106 cases of endocarditis compared the results of immunohistochemistry&#44; Western blotting and real-time PCR in whole blood&#44; serum and valvular tissue&#46; Immunohistochemistry and Warthin-Starry staining were the least sensitive techniques&#46; In this study&#44; Warthin-Starry staining was the more sensitive of these two methods &#40;five samples were positive for Warthin-Starry staining and negative in the immunohistochemical analysis&#41;&#46; However&#44; this histological stain is not specific for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; As the infectious process can be localized&#44; a negative immunohistochemical result does not definitively rule out the diagnosis of endocarditis by <span class="elsevierStyleItalic">Bartonella</span> spp&#46;<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> The isolation of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; is difficult&#44; even under specific and ideal conditions&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">Bacteremia was documented in the index case&#44; through the isolation of the bacteria in a solid medium even after one year of treatment with doxycycline&#44; but no isolation of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; was observed in any of the study participants&#46; The difficulty of treating the infection with antibiotics&#44; as seen in trench fever &#40;caused by <span class="elsevierStyleItalic">Bartonella quintana</span>&#41; and Oroya fever &#40;which is the first manifestation of biphasic Carrion&#39;s disease and can progress to <span class="elsevierStyleItalic">verruga Peruana</span>&#44; caused by <span class="elsevierStyleItalic">Bartonella bacilliformis</span>&#41;&#44; suggest that these bacteria are not eradicated&#46; This potential persistence of the infection makes it impossible to guarantee that manifestations observed in LV are infectious or post-infectious immune reactions&#44; as has been suggested&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">25</span></a></p><p id="par0085" class="elsevierStylePara elsevierViewall">Few research groups perform solid cultures for the isolation of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; This is due to the fact that isolation depends on specific media and prolonged incubation&#46; Additionally&#44; fastidious growth and lack of success in primary isolation make this type of diagnosis unfeasible&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">As LV is the cutaneous manifestation of different diseases&#44; infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; could be just one of the causes of this manifestation&#46; Moreover&#44; because it infects endothelial cells and is the only known genus of bacteria to stimulate its proliferation in humans&#44;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> the screening in blood samples may not represent the patient&#39;s actual condition in relation to the infection by these bacteria&#44; as bacteremia is usually cyclical&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">Data collected from the questionnaire regarding the risk factors for bartonellosis &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41; showed that the volunteers in the control group were significantly younger since most of these volunteers consisted of UNICAMP students&#46; LV affects more women and there was a statistical difference between the sex proportion in the groups&#46; One limitation of the study is the fact that the volunteers were more exposed to risk factors for acquiring <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#44; factors that were observed in a study carried out with blood donors from the UNICAMP Blood Bank&#44;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> since they reported&#44; in greater numbers&#44; when compared to the patients&#44; having suffered bites and scratches&#44; contact with pets and exposure to arthropods&#46; Even with lower risk exposure&#44; the group of patients with LV had twice the infection rate&#44; 25&#37; &#40;4&#47;16&#41;&#44; which may indicate that the prevalence of infection by <span class="elsevierStyleItalic">B&#46; henselae</span> in patients is higher and that these bacteria can&#44; in fact&#44; be related to disease onset&#46; Another explanation for not having found a statistically significant difference is the small number of patients in the study that evaluates patients with a rare disease&#44; which was carried out as a pilot study in a single institution&#46; As described in the results&#44; using volunteers with the same characteristics as the controls&#44; would take almost seven times more patients to document statistical significance&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">The lack of a reference diagnostic test&#44; combined with the great difficulty in detecting bacteremia caused by <span class="elsevierStyleItalic">Bartonella</span> spp&#46;&#44; reinforces the need to use diverse and complementary methods to increase the sensitivity and accuracy of the diagnosis&#46; This combination of methods and the testing of different samples makes the laboratory diagnosis more effective and has been used by different research groups&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#44;20&#44;28&#8211;30</span></a></p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Conclusion</span><p id="par0105" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">B&#46; henselae</span> DNA was detected in one out of four patients with primary LV&#44; which reinforces the need to investigate <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection in these individuals&#44; although there was no statistical difference between the patient group and the control group&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Financial support</span><p id="par0110" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleGrantSponsor" id="gs1">National Council for Scientific and Technological Development</span> &#40;CNPq&#41; for the scholarships granted&#58; <span class="elsevierStyleGrantNumber" refid="gs1">n&#46; 170501&#47;2018-3</span> &#40;LSS&#41;&#44; <span class="elsevierStyleGrantNumber" refid="gs1">n&#46; 313762&#47;2021-0</span> &#40;PENFV&#41; and <span class="elsevierStyleGrantNumber" refid="gs1">n&#46; 151006&#47;2021-0</span> &#40;MRD&#41;&#46; <span class="elsevierStyleGrantSponsor" id="gs2">S&#227;o Paulo Dermatology Support Fund &#40;Funadersp&#41; &#47; Brazilian Society of Dermatology&#44; Regional S&#227;o Paulo</span> &#40;Fran&#231;a&#44; AFEC&#41;&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Authors&#39; contributions</span><p id="par0115" class="elsevierStylePara elsevierViewall">Marina Rovani Drummond&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">Luciene Silva dos Santos&#58; Approval of the final version of the manuscript&#59; design and planning of the study&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">Lais Bomediano Souza&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the manuscript&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">Gabriela Nero Mitsuushi&#58; Approval of the final version of the manuscript&#59; design and planning of the study&#59; critical review of the literature&#59; participation in patient selection and sample collection&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Maria Let&#237;cia Cintra&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Andrea Fernandes Eloy da Costa Fran&#231;a&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">Elemir Macedo de Souza&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">Paulo Eduardo Neves Ferreira Velho&#58; Approval of the final version of the manuscript&#59; design and planning of the study&#59; participation in patient selection and sample collection&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Conflicts of interest</span><p id="par0155" class="elsevierStylePara elsevierViewall">None declared&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres1923542"
          "titulo" => "Abstract"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Objective"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Study limitations"
            ]
            5 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1658949"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:2 [
          "identificador" => "sec0010"
          "titulo" => "Methods"
        ]
        4 => array:2 [
          "identificador" => "sec0015"
          "titulo" => "Results"
        ]
        5 => array:2 [
          "identificador" => "sec0020"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0025"
          "titulo" => "Conclusion"
        ]
        7 => array:2 [
          "identificador" => "sec0030"
          "titulo" => "Financial support"
        ]
        8 => array:2 [
          "identificador" => "sec0035"
          "titulo" => "Authors&#39; contributions"
        ]
        9 => array:2 [
          "identificador" => "sec0040"
          "titulo" => "Conflicts of interest"
        ]
        10 => array:2 [
          "identificador" => "xack673911"
          "titulo" => "Acknowledgments"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-05-18"
    "fechaAceptado" => "2022-07-21"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1658949"
          "palabras" => array:3 [
            0 => "Bartonella"
            1 => "Livedoid vasculopathy"
            2 => "Skin ulcer"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Livedoid vasculopathy &#40;LV&#41; manifests as ulcers and atrophic white scars on the lower extremities&#46; The main known etiopathogenesis is hypercoagulability with thrombus formation&#44; followed by inflammation&#46; Thrombophilia&#44; collagen and myeloproliferative diseases may induce LV&#44; but the idiopathic &#40;primary&#41; form predominates&#46; <span class="elsevierStyleItalic">Bartonella</span> spp&#46; may cause intra-endothelial infection and skin manifestations caused by these bacteria may be diverse&#44; including leukocytoclastic vasculitis and ulcers&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Objective</span><p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">The aim of this study was to investigate the presence of bacteremia by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in patients with difficult-to-control chronic ulcers diagnosed as primary LV&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Questionnaires and molecular tests &#40;conventional PCR&#44; nested PCR and real-time PCR&#41; were applied and liquid and solid cultures were performed in the blood samples and blood clot of 16&#160;LV patients and 32 healthy volunteers&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0065" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Bartonella henselae</span> DNA was detected in 25&#37; of LV patients and in 12&#46;5&#37; of control subjects but failed to reach statistically significant differences &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;413&#41;&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Study limitations</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Due to the rarity of primary LV&#44; the number of patients studied was small and there was greater exposure of the control group to risk factors for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Conclusion</span><p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Although there was no statistically significant difference between the groups&#44; the DNA of <span class="elsevierStyleItalic">B&#46; henselae</span> was detected in one of every four patients&#44; which reinforces the need to investigate <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in patients with primary LV&#46;</p></span>"
        "secciones" => array:6 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Objective"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Study limitations"
          ]
          5 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:2 [
        "etiqueta" => "&#8902;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Study conducted at the Faculty of Medical Sciences&#44; Universidade Estadual de Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#46;</p>"
      ]
    ]
    "multimedia" => array:7 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2292
            "Ancho" => 1508
            "Tamanyo" => 198676
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Right foot&#44; aspect of the dorsum one year after onset of the condition&#58; mild livedo racemosa&#44; hypochromic atrophic scars with telangiectasias&#44; ulcers with erythematous background&#44; some covered by fibrinopurulent tissue and others by hematic crusts&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1105
            "Ancho" => 1675
            "Tamanyo" => 210907
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Right foot&#44; aspect of the dorsum&#58; pustules and ulcers with erythematous background&#44; many crusts and concretions&#44; hypochromic atrophic lesions and other hyperchromic ones&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1659
            "Ancho" => 2508
            "Tamanyo" => 1105933
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Chronic ulcer&#58; &#40;A&#41; hyperplastic epidermis at the edge &#40;red arrow&#41;&#44; vessels with hyalinized walls at the edge and in the ulcer bed &#40;black arrows&#41;&#44; inflammatory cell aggregates and fibrosis of the reticular dermis and hypodermis&#59; &#40;B&#41; wall hyalinosis and occlusive thrombosis of the lumen in the dermis and hypodermis vessels &#40;yellow arrows&#41;&#44; with inflammatory exudate containing polymorphonuclear neutrophils&#46; Hematoxylin &#38; eosin&#44; x40 &#40;A&#41; and x100 &#40;B&#41;&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1226
            "Ancho" => 3341
            "Tamanyo" => 211491
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0020"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Flowchart of the procedures performed&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0025"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">&#43;&#44; detected DNA&#59; <span class="elsevierStyleItalic">&#8722;</span>&#44; DNA not detected&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Sample</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Whole blood</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Liquid culture</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Solid culture</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Conventional PCR &#40;ITS&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Nested PCR &#40;<span class="elsevierStyleItalic">fstZ</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Conventional PCR &#40;ITS&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Nested PCR &#40;<span class="elsevierStyleItalic">fstZ</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Conventional PCR &#40;ITS&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Nested PCR &#40;<span class="elsevierStyleItalic">fstZ</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">November&#47;2012 &#40;under antibiotic treatment&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">No growth</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">No growth</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">December&#47;2013 &#40;without antibiotic treatment&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Results of molecular investigations in the index case of primary livedoid vasculopathy with bacteremia confirmed by <span class="elsevierStyleItalic">Bartonella henselae&#46;</span></p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0030"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">PCR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence of nucleotides &#40;5&#39;-3&#39;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Molecular target&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Conventional<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCTTCATTGACCTCAACTACAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCAAACTTGTCATGGATGACC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Conventional<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ITS F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTCAGATGATGATCCCAAGCCTTYTGGCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ITS</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ITS R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAACCGACGACCCCCTGCTTGCAAAGCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Double amplification &#40;nested&#41;<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCCGCAAAGTTCTTTTCATG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">ftsZ</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGGTGAACGCGCTTGTATTTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAAAACGGTTGGAGAGCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGCCTGTCATCTCATCAAGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Real-time<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CS F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ATGGGTTTTGGTCATCGAGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">gltA</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CS R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AAATCGACATTAGGGTAAAGTTTTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Primers used in the molecular investigation of the patient and control groups&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0035"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">p</span>-values shown in <span class="elsevierStyleBold">bold</span> in the tables are statistically significant&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Control &#40;n&#160;&#61;&#160;32&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Livedoid vasculopathy &#40;n&#160;&#61;&#160;16&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Total &#40;n&#160;&#61;&#160;48&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#40;Mean&#160;&#177;&#160;SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#46;71&#160;&#177;&#160;8&#46;57&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">37&#46;62&#160;&#177;&#160;9&#46;76&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30&#46;35&#160;&#177;&#160;10&#46;29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span><a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#40;Median &#40;min&#8210;max&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23&#46;00 &#40;18&#46;0&#8211;51&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">39&#46;50 &#40;15&#46;0&#8211;51&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&#46;50 &#40;15&#46;0&#8211;51&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;39&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;29&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">33 &#40;68&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;048</span><a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;27&#46;1&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;4&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;31&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Contact with housepets&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;10&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;19&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;29&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;007</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26 &#40;55&#46;3&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;14&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">33 &#40;70&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;66&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;34&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Contact with wild animals&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;286<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;58&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">44 &#40;91&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Bite or Scratch&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27 &#40;56&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;000</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;14&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;27&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;41&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Missing&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;2&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;2&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Exposure to arthropods&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29 &#40;60&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;16&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">37 &#40;77&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;003</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;16&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11 &#40;22&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Detection of <span class="elsevierStyleItalic">Bartonella henselae</span> DNA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;35&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;16&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;413<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;58&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12 &#40;25&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40 &#40;83&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
          "notaPie" => array:3 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Mann-Whitney test&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Fisher&#8217;s test&#46;</p>"
            ]
            2 => array:3 [
              "identificador" => "tblfn0015"
              "etiqueta" => "c"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Chi-square test&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Comparison between the control group and the group of patients with livedoid vasculopathy&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:30 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Livedoid vasculopathy&#58; an intringuing cutaneous disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;R&#46; Criado"
                            1 => "E&#46;A&#46; Rivitti"
                            2 => "M&#46;N&#46; Sotto"
                            3 => "N&#46;Y&#46; Sakai Valente"
                            4 => "V&#46; Aoki"
                            5 => "J&#46;F&#46; de Carvalho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/s0365-05962011000500015"
                      "Revista" => array:6 [
                        "tituloSerie" => "An Bras Dermatol&#46;"
                        "fecha" => "2011"
                        "volumen" => "86"
                        "paginaInicial" => "961"
                        "paginaFinal" => "977"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22147037"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Livedoid vasculopathy&#58; review of pathogenesis&#44; clinical presentation&#44; diagnostic workup&#44; and treatment"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G&#46;T&#46; Haunson"
                            1 => "D&#46;W&#46; Judy"
                            2 => "N&#46;C&#46; Prall"
                            3 => "R&#46;A&#46; Mille"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Cutis&#46;"
                        "fecha" => "2012"
                        "volumen" => "90"
                        "paginaInicial" => "302"
                        "paginaFinal" => "306"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23409480"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1074761321001175"
                          "estado" => "S300"
                          "issn" => "10747613"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonellosis&#44; One Health and all creatures great and small"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "E&#46;B&#46; Breitschwerdt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Vet Dermatol&#46;"
                        "fecha" => "2017"
                        "volumen" => "28"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cutaneous manifestations of bartonellosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "K&#46;A&#46; Lins"
                            1 => "M&#46;R&#46; Drummond"
                            2 => "P&#46;E&#46;N&#46;F&#46; Velho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.abd.2019.09.024"
                      "Revista" => array:6 [
                        "tituloSerie" => "An Bras Dermatol&#46;"
                        "fecha" => "2019"
                        "volumen" => "94"
                        "paginaInicial" => "594"
                        "paginaFinal" => "602"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31780437"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella spp&#46; bacteremia in blood donors from Campinas"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46;H&#46; Pitassi"
                            1 => "P&#46;P&#46; de Paiva Diniz"
                            2 => "D&#46;G&#46; Scorpio"
                            3 => "M&#46;R&#46; Drummond"
                            4 => "B&#46;G&#46; Lania"
                            5 => "M&#46;L&#46; Barjas-Castro"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Brazil&#46; PLoS Negl Trop Dis&#46;"
                        "fecha" => "2015"
                        "volumen" => "9"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Improvement of Bartonella henselae DNA detection in cat blood samples by combining molecular and culture methods"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;R&#46; Drummond"
                            1 => "B&#46;G&#46; Lania"
                            2 => "P&#46;P&#46;V&#46;P&#46; Diniz"
                            3 => "R&#46; Gilioli"
                            4 => "D&#46;M&#46;R&#46; Demolin"
                            5 => "D&#46;G&#46; Scorpio"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.01732-17"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2018"
                        "volumen" => "56"
                        "paginaInicial" => "e01732"
                        "paginaFinal" => "17"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29540455"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae bacteremia diagnosed post-mortem in a myelodysplastic syndrome patient"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;R&#46; Drummond"
                            1 => "L&#46; Visentainer"
                            2 => "A&#46;R&#46; Almeida"
                            3 => "R&#46;N&#46; Angerami"
                            4 => "F&#46;H&#46; Aoki"
                            5 => "P&#46;E&#46;N&#46;F&#46; Velho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/S1678-9946201961050"
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2019"
                        "volumen" => "61"
                        "paginaInicial" => "e50"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31531628"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multiplex SYBR&#174; green-real time PCR &#40;qPCR&#41; assay for the detection and differentiation of Bartonella henselae and Bartonella clarridgeiae in cats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46; Staggemeier"
                            1 => "D&#46;A&#46; Pilger"
                            2 => "F&#46;R&#46; Spilki"
                            3 => "V&#46;V&#46; Cantarelli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2014"
                        "volumen" => "56"
                        "paginaInicial" => "93"
                        "paginaFinal" => "95"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni &#40;Asian genotype&#41; and B&#46; canis DNA in canine blood samples"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46;J&#46; Birkenheuer"
                            1 => "M&#46;G&#46; Levy"
                            2 => "E&#46;B&#46; Breitschwerdt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.41.9.4172-4177.2003"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2003"
                        "volumen" => "41"
                        "paginaInicial" => "4172"
                        "paginaFinal" => "4177"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12958243"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1473309920302346"
                          "estado" => "S300"
                          "issn" => "14733099"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Canine bartonellosis&#58; serological and molecular prevalence in Brazil and evidence of co-infection with Bartonella henselae and Bartonella vinsonii subsp&#46; berkhoffii"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;P&#46;V&#46;P&#46; Diniz"
                            1 => "R&#46;G&#46; Maggi"
                            2 => "D&#46;S&#46; Schwartz"
                            3 => "M&#46;B&#46; Cadenas"
                            4 => "J&#46;M&#46; Bradley"
                            5 => "B&#46; Hegarty"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Vet Res&#46;"
                        "fecha" => "2007"
                        "volumen" => "38"
                        "paginaInicial" => "697"
                        "paginaFinal" => "710"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of Bartonella henselae DNA in clinical samples including peripheral blood of immune competent and immune compromised patients by three nested amplifications"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "K&#46;H&#46; Kawasato"
                            1 => "L&#46;C&#46; de Oliveira"
                            2 => "P&#46;E&#46; Velho"
                            3 => "L&#46; Yamamoto"
                            4 => "G&#46;M&#46;B&#46; Del Negro"
                            5 => "T&#46;S&#46; Okay"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/s0036-46652013000100001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2013"
                        "volumen" => "55"
                        "paginaInicial" => "1"
                        "paginaFinal" => "6"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23328718"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cutaneous manifestations of SARS-CoV-2 infection&#58; a clinical update"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "P&#46; Gisondi"
                            1 => "S&#46; PIaserico"
                            2 => "C&#46; Bordin"
                            3 => "M&#46; Alaibac"
                            4 => "G&#46; Girolomoni"
                            5 => "L&#46; Naldi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jdv.16774"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Eur Acad Dermatol Venereol&#46;"
                        "fecha" => "2020"
                        "volumen" => "34"
                        "paginaInicial" => "2499"
                        "paginaFinal" => "2504"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32585074"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0161642011007895"
                          "estado" => "S300"
                          "issn" => "01616420"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Unknown fever and back pain caused by Bartonella henselae in a veterinarian after a needle puncture&#58; a case report and literature review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;W&#46; Lin"
                            1 => "C&#46;M&#46; Chen"
                            2 => "C&#46;C&#46; Chang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Vector Borne Zoonotic Dis&#46;"
                        "fecha" => "2011"
                        "volumen" => "11"
                        "paginaInicial" => "589"
                        "paginaFinal" => "591"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chronic Bartonella quintana bacteremia in homeless patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "P&#46; Brouqui"
                            1 => "B&#46; Lascola"
                            2 => "V&#46; Roux"
                            3 => "D&#46; Raoult"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJM199901213400303"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med&#46;"
                        "fecha" => "1999"
                        "volumen" => "340"
                        "paginaInicial" => "184"
                        "paginaFinal" => "189"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9895398"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infections in an owner and two Papillon dogs exposed to tropical rat mites &#40;Ornithonyssus bacoti&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;M&#46; Bradley"
                            1 => "P&#46;E&#46; Mascarelli"
                            2 => "C&#46;L&#46; Trull"
                            3 => "R&#46;G&#46; Maggi"
                            4 => "E&#46;B&#46; Breitschwerdt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/vbz.2013.1492"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vector Borne Zoonotic Dis&#46;"
                        "fecha" => "2014"
                        "volumen" => "14"
                        "paginaInicial" => "703"
                        "paginaFinal" => "709"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25325313"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infection induces persistent mechanical hypersensitivity in mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Vieira-Damiani"
                            1 => "A&#46;R&#46; Almeida"
                            2 => "M&#46;N&#46; Silva"
                            3 => "B&#46;G&#46; Lania"
                            4 => "T&#46;C&#46;B&#46; Soares"
                            5 => "M&#46;R&#46; Drummond"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/S1678-9946202062079"
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2020"
                        "volumen" => "62"
                        "paginaInicial" => "e79"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33146308"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infection in sickle cell disease mice is associated with hyperalgesia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;R&#46; de Almeida"
                            1 => "G&#46; Vieira-Damiani"
                            2 => "M&#46;N&#46; da Silva"
                            3 => "B&#46;G&#46; Lania"
                            4 => "T&#46;C&#46;B&#46; Soares"
                            5 => "M&#46;R&#46; Drummond"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/vbz.2018.2331"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vector Borne Zoonotic Dis&#46;"
                        "fecha" => "2019"
                        "volumen" => "19"
                        "paginaInicial" => "102"
                        "paginaFinal" => "105"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30272535"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Activation of hypoxia-inducible factor-1 in bacillary angiomatosis&#58; evidence for a role of hypoxia-inducible factor-1 in bacterial infections"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "V&#46;A&#46; Kempf"
                            1 => "M&#46; Lebiedziejewski"
                            2 => "K&#46; Alitalo"
                            3 => "J&#46;H&#46; W&#228;lzlein"
                            4 => "U&#46; Ehehalt"
                            5 => "J&#46; Fiebig"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Circulation&#46;"
                        "fecha" => "2005"
                        "volumen" => "111"
                        "paginaInicial" => "1054"
                        "paginaFinal" => "1062"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A novel potent vasoconstrictor peptide produced by vascular endothelial cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Yanagisawa"
                            1 => "H&#46; Kurihara"
                            2 => "S&#46; Kimura"
                            3 => "Y&#46; Tomobe"
                            4 => "M&#46; Kobayashi"
                            5 => "Y&#46; Mitsui"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/332411a0"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nature&#46;"
                        "fecha" => "1988"
                        "volumen" => "332"
                        "paginaInicial" => "411"
                        "paginaFinal" => "415"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2451132"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella&#44; a common cause of endocarditis&#58; a report on 106 cases and review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Edouard"
                            1 => "C&#46; Nabet"
                            2 => "H&#46; Lepidi"
                            3 => "P&#46;E&#46; Fournier"
                            4 => "D&#46; Raoult"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2015"
                        "volumen" => "53"
                        "paginaInicial" => "824"
                        "paginaFinal" => "829"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella vinsonii subsp&#46; arupensis infection in animals of veterinary importance&#44; ticks and biopsy samples"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "D&#46; Chochlakis"
                            1 => "S&#46; Cutler"
                            2 => "N&#46;D&#46; Giadinis"
                            3 => "A&#46; Psaroulaki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "New Microbes New Infect&#46;"
                        "fecha" => "2020"
                        "volumen" => "34"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Paraffin-embedded tissue&#58; an alternative to Bartonella sp&#46; infection diagnosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "L&#46; Silva Dos Santos"
                            1 => "M&#46;R&#46; Drummond"
                            2 => "E&#46;C&#46; Fran&#231;a"
                            3 => "M&#46;L&#46; Cintra"
                            4 => "P&#46;E&#46;N&#46;F&#46; Velho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/ddg.13607"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Dtsch Dermatol Ges&#46;"
                        "fecha" => "2018"
                        "volumen" => "16"
                        "paginaInicial" => "1147"
                        "paginaFinal" => "1148"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24251729"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1888429616000212"
                          "estado" => "S300"
                          "issn" => "18884296"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular diagnosis of skin infections using paraffin-embedded tissue - review and interdisciplinary consensus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Sunderk&#246;tter"
                            1 => "K&#46; Becker"
                            2 => "H&#46; Kutzner"
                            3 => "T&#46; Meyer"
                            4 => "N&#46; Bl&#246;dorn-Schlicht"
                            5 => "U&#46; Reischl"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/ddg.13438_g"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Dtsch Dermatol Ges&#46;"
                        "fecha" => "2018"
                        "volumen" => "16"
                        "paginaInicial" => "139"
                        "paginaFinal" => "147"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29418100"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of immunohistochemistry in identifying Bartonella henselae in cat-scratch disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "G&#46;C&#46; Caponetti"
                            1 => "L&#46; Pantanowitz"
                            2 => "S&#46; Marconi"
                            3 => "J&#46;M&#46; Havens"
                            4 => "L&#46;W&#46; Lamps"
                            5 => "C&#46;N&#46; Otis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1309/AJCPMNULMO9GPLYU"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Clin Pathol&#46;"
                        "fecha" => "2009"
                        "volumen" => "131"
                        "paginaInicial" => "250"
                        "paginaFinal" => "256"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19141385"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infection-associated vasculitis and crescentic glomerulonephritis leading to renal allograft loss"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46;R&#46; Chaudhry"
                            1 => "M&#46;R&#46; Chaudhry"
                            2 => "J&#46;C&#46; Papadimitriou"
                            3 => "C&#46;B&#46; Drachenberg"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/tid.12376"
                      "Revista" => array:7 [
                        "tituloSerie" => "Transpl Infect Dis&#46;"
                        "fecha" => "2015"
                        "volumen" => "17"
                        "paginaInicial" => "411"
                        "paginaFinal" => "417"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25753276"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0163445321000360"
                          "estado" => "S300"
                          "issn" => "01634453"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella-associated endothelial proliferation depends on inhibition of apoptosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;E&#46; Kirby"
                            1 => "D&#46;M&#46; Nekorchuk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.072292699"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci U S A&#46;"
                        "fecha" => "2002"
                        "volumen" => "99"
                        "paginaInicial" => "4656"
                        "paginaFinal" => "4661"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11904386"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk Factors for Bartonella species Infection in Blood Donors from Southeast Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;P&#46; Diniz"
                            1 => "P&#46;E&#46; Velho"
                            2 => "L&#46;H&#46; Pitassi"
                            3 => "M&#46;R&#46; Drummond"
                            4 => "B&#46;G&#46; Lania"
                            5 => "M&#46;L&#46; Barjas-Castro"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "PLoS Negl Trop Dis&#46;"
                        "fecha" => "2016"
                        "volumen" => "10"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Testing for Bartonella ssp&#46; DNA in cerebrospinal fluid of dogs with inflammatory central nervous system disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Bartner"
                            1 => "S&#46; McGrath"
                            2 => "A&#46; Drury"
                            3 => "A&#46;V&#46; Chen"
                            4 => "A&#46; Morris"
                            5 => "M&#46; Brewer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jvim.15288"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Vet Intern Med&#46;"
                        "fecha" => "2018"
                        "volumen" => "32"
                        "paginaInicial" => "1983"
                        "paginaFinal" => "1988"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30381844"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prospective serological and molecular cross-sectional study focusing on Bartonella and other blood-borne organisms in cats from Catalonia &#40;Spain&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; &#193;lvarez-Fern&#225;ndez"
                            1 => "R&#46; Maggi"
                            2 => "G&#46;E&#46; Mart&#237;n-Valls"
                            3 => "M&#46; Baxarias"
                            4 => "E&#46;B&#46; Breitschwerdt"
                            5 => "L&#46; Solano-Gallego"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s13071-021-05105-6"
                      "Revista" => array:5 [
                        "tituloSerie" => "Parasites Vectors&#46;"
                        "fecha" => "2022"
                        "volumen" => "15"
                        "paginaInicial" => "6"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34983610"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella spp&#46; bacteremia in high-risk immunocompetent patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46;G&#46; Maggi"
                            1 => "P&#46;E&#46; Mascarelli"
                            2 => "E&#46;L&#46; Pultorak"
                            3 => "B&#46;C&#46; Hegarty"
                            4 => "J&#46;M&#46; Bradley"
                            5 => "B&#46;R&#46; Mozayeni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.diagmicrobio.2011.09.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diagn Microbiol Infect Dis&#46;"
                        "fecha" => "2011"
                        "volumen" => "71"
                        "paginaInicial" => "430"
                        "paginaFinal" => "437"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21996096"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack673911"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="par0160" class="elsevierStylePara elsevierViewall">The authors would like to thank the S&#227;o Paulo State Dermatology Support Fund - Sebasti&#227;o Sampaio &#40;Funadersp&#41; for the research funding granted to carry out this research&#46; They also thank the National Council for Scientific and Technological Development &#40;<span class="elsevierStyleItalic">Conselho Nacional de Desenvolvimento Cient&#237;fico e Tecnol&#243;gico</span>&#41; for the scholarships granted&#58; n&#46; 170501&#47;2018-3 &#40;LSS&#41;&#44; n&#46; 313762&#47;2021-0 &#40;PENFV&#41; and n&#46; 151006&#47;2021-0 &#40;MRD&#41;&#46; The sponsors did not have any influence in the study design&#44; data collection and analysis&#44; publication decision&#44; or manuscript preparation&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03650596/0000009800000004/v1_202307031010/S0365059623000661/v1_202307031010/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "89516"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Article"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03650596/0000009800000004/v1_202307031010/S0365059623000661/v1_202307031010/en/main.pdf?idApp=UINPBA00008Z&text.app=https://clinics.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623000661?idApp=UINPBA00008Z"
]
Compartilhar
Informação da revista

Estatísticas

Siga este link para acessar o texto completo do artigo

Original Article
Detection of Bartonella henselae DNA in the blood of patients with livedoid vasculopathy
Marina Rovani Drummonda,b,
Autor para correspondência
mrovani@unicamp.br

Corresponding author.
, Luciene Silva dos Santosa,b, Lais Bomediano Souzac, Gabriela Nero Mitsuushia, Maria Letícia Cintrad, Andrea Fernandes Eloy da Costa Françaa, Elemir Macedo de Souzaa, Paulo Eduardo Neves Ferreira Velhoa,b
a Department of Clinical Medicine, School of Medical Sciences, Universidade Estadual de Campinas, Campinas, São Paulo, SP, Brazil
b Laboratory of Applied Research in Dermatology and Bartonella Infection, School of Medical Sciences, Universidade Estadual de Campinas, Campinas, São Paulo, SP, Brazil
c Department of Medicine, Pontifícia Universidade Católica de Campinas, Campinas, São Paulo, SP, Brazil
d Department of Pathological Anatomy, School of Medical Sciences, Universidade Estadual de Campinas, Campinas, São Paulo, SP, Brazil
Lido
3612
Vezes
que se leu este artigo
1500
Total PDF
2112
Total HTML
Compartilhar estatísticas
 array:23 [
  "pii" => "S0365059623000661"
  "issn" => "03650596"
  "doi" => "10.1016/j.abd.2022.07.007"
  "estado" => "S300"
  "fechaPublicacion" => "2023-07-01"
  "aid" => "747"
  "copyright" => "Sociedade Brasileira de Dermatologia"
  "copyrightAnyo" => "2023"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "pt" => array:18 [
      "pii" => "S2666275223000942"
      "issn" => "26662752"
      "doi" => "10.1016/j.abdp.2023.03.025"
      "estado" => "S300"
      "fechaPublicacion" => "2023-07-01"
      "aid" => "747"
      "copyright" => "Sociedade Brasileira de Dermatologia"
      "documento" => "article"
      "crossmark" => 1
      "subdocumento" => "fla"
      "abierto" => array:3 [
        "ES" => false
        "ES2" => false
        "LATM" => false
      ]
      "gratuito" => false
      "lecturas" => array:1 [
        "total" => 0
      ]
      "pt" => array:12 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Artigo original</span>"
        "titulo" => "Detec&#231;&#227;o do DNA de <span class="elsevierStyleItalic">Bartonella henselae</span> no sangue de pacientes com vasculopatia livedoide"
        "tienePdf" => "pt"
        "tieneTextoCompleto" => "pt"
        "tieneResumen" => "pt"
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "472"
            "paginaFinal" => "479"
          ]
        ]
        "contieneResumen" => array:1 [
          "pt" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "pt" => true
        ]
        "contienePdf" => array:1 [
          "pt" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0015"
            "etiqueta" => "Figura 3"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr3.jpeg"
                "Alto" => 1659
                "Ancho" => 2508
                "Tamanyo" => 1105933
              ]
            ]
            "descripcion" => array:1 [
              "pt" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">&#218;lcera cr&#244;nica&#58; &#40;A&#41; epiderme hiperpl&#225;sica na borda &#40;seta vermelha&#41;&#44; vasos com paredes hialinizadas na borda e no leito da &#250;lcera &#40;setas pretas&#41;&#44; agregados de c&#233;lulas inflamat&#243;rias e fibrose da derme reticular e hipoderme&#59; &#40;B&#41; hialinose da parede e trombose oclusiva da luz dos vasos da derme e hipoderme &#40;setas amarelas&#41;&#44; com exsudato inflamat&#243;rio contendo neutr&#243;filos polimorfonucleares&#46; Hematoxilina&#8208;eosina&#44; x40 &#40;A&#41; e x100 &#40;B&#41;&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Marina Rovani Drummond, Luciene Silva dos Santos, Lais Bomediano Souza, Gabriela Nero Mitsuushi, Maria Let&#237;cia Cintra, Andrea Fernandes Eloy da Costa Fran&#231;a, Elemir Macedo de Souza, Paulo Eduardo Neves Ferreira Velho"
            "autores" => array:8 [
              0 => array:2 [
                "nombre" => "Marina Rovani"
                "apellidos" => "Drummond"
              ]
              1 => array:2 [
                "nombre" => "Luciene Silva dos"
                "apellidos" => "Santos"
              ]
              2 => array:2 [
                "nombre" => "Lais Bomediano"
                "apellidos" => "Souza"
              ]
              3 => array:2 [
                "nombre" => "Gabriela Nero"
                "apellidos" => "Mitsuushi"
              ]
              4 => array:2 [
                "nombre" => "Maria Let&#237;cia"
                "apellidos" => "Cintra"
              ]
              5 => array:2 [
                "nombre" => "Andrea Fernandes Eloy da Costa"
                "apellidos" => "Fran&#231;a"
              ]
              6 => array:2 [
                "nombre" => "Elemir Macedo de"
                "apellidos" => "Souza"
              ]
              7 => array:2 [
                "nombre" => "Paulo Eduardo Neves Ferreira"
                "apellidos" => "Velho"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "pt"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S0365059623000661"
          "doi" => "10.1016/j.abd.2022.07.007"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623000661?idApp=UINPBA00008Z"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223000942?idApp=UINPBA00008Z"
      "url" => "/26662752/0000009800000004/v2_202307101646/S2666275223000942/v2_202307101646/pt/main.assets"
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S036505962300048X"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2022.02.008"
    "estado" => "S300"
    "fechaPublicacion" => "2023-07-01"
    "aid" => "729"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Immunohistochemical detection of <span class="elsevierStyleItalic">Treponema pallidum</span> in skin samples with clinical and histopathological correlations and Warthin-Starry staining critical analysis"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "480"
          "paginaFinal" => "486"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1193
              "Ancho" => 3341
              "Tamanyo" => 532036
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0085"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">&#40;A&#41; Basal cell layer background staining &#40;Warthin-Starry staining&#44; &#215;1000&#41;&#46; &#40;B&#41; Unspecified structures in dermis &#40;arrows&#44; Warthin-Starry staining&#44; &#215;1000&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Mariana Freitas de Assis Pereira Rosa, Leonardo Pereira Quintella, Luiz Claudio Ferreira, Tullia Cuzzi"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Mariana Freitas de Assis Pereira"
              "apellidos" => "Rosa"
            ]
            1 => array:2 [
              "nombre" => "Leonardo Pereira"
              "apellidos" => "Quintella"
            ]
            2 => array:2 [
              "nombre" => "Luiz Claudio"
              "apellidos" => "Ferreira"
            ]
            3 => array:2 [
              "nombre" => "Tullia"
              "apellidos" => "Cuzzi"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275223000565"
        "doi" => "10.1016/j.abdp.2023.03.006"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223000565?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S036505962300048X?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000004/v1_202307031010/S036505962300048X/v1_202307031010/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S0365059623000569"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2022.09.007"
    "estado" => "S300"
    "fechaPublicacion" => "2023-07-01"
    "aid" => "737"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Cutaneous manifestations of COVID-19 patients in a Hospital in S&#227;o Paulo&#44; Brazil&#44; and global literature review"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "466"
          "paginaFinal" => "471"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1474
              "Ancho" => 1508
              "Tamanyo" => 236729
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0005"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Erythematous rash containing macules and papules&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Silmara da Costa Pereira Cestari, Marcela da Costa Pereira Cestari, Gabriela Franco Marques, Ivana Lirio, Reinaldo Tovo, Ilana Cruz Silva Labriola"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Silmara da Costa Pereira"
              "apellidos" => "Cestari"
            ]
            1 => array:2 [
              "nombre" => "Marcela da Costa Pereira"
              "apellidos" => "Cestari"
            ]
            2 => array:2 [
              "nombre" => "Gabriela Franco"
              "apellidos" => "Marques"
            ]
            3 => array:2 [
              "nombre" => "Ivana"
              "apellidos" => "Lirio"
            ]
            4 => array:2 [
              "nombre" => "Reinaldo"
              "apellidos" => "Tovo"
            ]
            5 => array:2 [
              "nombre" => "Ilana"
              "apellidos" => "Cruz Silva Labriola"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275223000838"
        "doi" => "10.1016/j.abdp.2023.03.015"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => false
          "ES2" => false
          "LATM" => false
        ]
        "gratuito" => false
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275223000838?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623000569?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000004/v1_202307031010/S0365059623000569/v1_202307031010/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Detection of <span class="elsevierStyleItalic">Bartonella henselae</span> DNA in the blood of patients with livedoid vasculopathy"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "472"
        "paginaFinal" => "479"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Marina Rovani Drummond, Luciene Silva dos Santos, Lais Bomediano Souza, Gabriela Nero Mitsuushi, Maria Let&#237;cia Cintra, Andrea Fernandes Eloy da Costa Fran&#231;a, Elemir Macedo de Souza, Paulo Eduardo Neves Ferreira Velho"
        "autores" => array:8 [
          0 => array:4 [
            "nombre" => "Marina Rovani"
            "apellidos" => "Drummond"
            "email" => array:1 [
              0 => "mrovani@unicamp.br"
            ]
            "referencia" => array:3 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
              2 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Luciene Silva dos"
            "apellidos" => "Santos"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Lais Bomediano"
            "apellidos" => "Souza"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Gabriela Nero"
            "apellidos" => "Mitsuushi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Maria Let&#237;cia"
            "apellidos" => "Cintra"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
          5 => array:3 [
            "nombre" => "Andrea Fernandes Eloy da Costa"
            "apellidos" => "Fran&#231;a"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          6 => array:3 [
            "nombre" => "Elemir Macedo de"
            "apellidos" => "Souza"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          7 => array:3 [
            "nombre" => "Paulo Eduardo Neves Ferreira"
            "apellidos" => "Velho"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Department of Clinical Medicine&#44; School of Medical Sciences&#44; Universidade Estadual de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Laboratory of Applied Research in Dermatology and Bartonella Infection&#44; School of Medical Sciences&#44; Universidade Estadual de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Department of Medicine&#44; Pontif&#237;cia Universidade Cat&#243;lica de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Department of Pathological Anatomy&#44; School of Medical Sciences&#44; Universidade Estadual de Campinas&#44; Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1659
            "Ancho" => 2508
            "Tamanyo" => 1105933
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Chronic ulcer&#58; &#40;A&#41; hyperplastic epidermis at the edge &#40;red arrow&#41;&#44; vessels with hyalinized walls at the edge and in the ulcer bed &#40;black arrows&#41;&#44; inflammatory cell aggregates and fibrosis of the reticular dermis and hypodermis&#59; &#40;B&#41; wall hyalinosis and occlusive thrombosis of the lumen in the dermis and hypodermis vessels &#40;yellow arrows&#41;&#44; with inflammatory exudate containing polymorphonuclear neutrophils&#46; Hematoxylin &#38; eosin&#44; x40 &#40;A&#41; and x100 &#40;B&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Livedoid vasculopathy &#40;LV&#41; manifests as painful ulcers located distally on the lower limbs&#44; which slowly develop into whitish atrophic lesions&#44; with punctate telangiectasias&#44; brownish pigmentation&#44; accompanied by livedo racemosa&#46; The most often accepted LV etiopathogenesis comprises vaso-occlusive phenomena resulting from hypercoagulable states&#46; Conditions such as thrombophilia&#44; diffuse connective tissue diseases &#44; myeloproliferative disorders&#44; and blood stasis are known to be associated with the disease&#44; but the idiopathic &#40;primary&#41; form is the predominant one&#46;<a class="elsevierStyleCrossRefs" href="#bib0005"><span class="elsevierStyleSup">1&#44;2</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">This study was carried out based on the clinical observation of a 41-year-old patient&#44; with a history of contact with cats and who had ulcerated lesions on the lower limbs that were difficult to control for 12 years &#40;<a class="elsevierStyleCrossRefs" href="#fig0005">Figs&#46; 1 and 2</a>&#41;&#46; Histopathology showed hypodermitis associated with leukocytoclastic vasculitis and the presence of frequent hyaline thrombi&#44; with fibrinoid necrosis of small vessel walls&#46; Mucin and hemosiderin deposits were also observed&#44; in addition to vascular proliferation &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; After excluding other diseases&#44; the patient was managed as a case of primary LV and treated over the years with vasodilators&#44; antiplatelet agents&#44; corticosteroids&#44; and cycles of antibiotics &#40;metronidazole&#44; penicillin&#44; and ciprofloxacin&#41;&#44; with transient improvement&#46; Considering the strong epidemiology of contact with cats&#44; screening for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; was suggested&#46; <span class="elsevierStyleItalic">Bartonella henselae</span> DNA was detected by polymerase chain reaction &#40;PCR&#41; in the patient&#39;s blood and there was a prompt improvement of the chronic ulcers with treatment of the <span class="elsevierStyleItalic">B&#46; henselae</span> infection with doxycycline 200&#160;mg&#47;day for one year&#46; After treatment withdrawal&#44; however&#44; the LV lesions recurred&#46; The bacterium was isolated and its DNA was once again detected in a new blood sample &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0015" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Bartonella</span> spp&#46; are fastidious bacteria and&#44; therefore&#44; difficult to isolate&#46; Although distributed worldwide&#44; they are neglected and life-threatening microorganisms that often live inside erythrocytes and endothelial cells&#46; Infection by these bacteria can be asymptomatic&#44; but can also cause a variety of clinical conditions in humans&#44; including fever of unknown origin&#44; endocarditis&#44; and cat-scratch disease&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> Cutaneous manifestations also vary and include leukocytoclastic vasculitis and ulcers&#44; as reviewed by Lins et al&#46; in a recent review of the cutaneous manifestations of bartonellosis published in this journal&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> The main objective of the present study was to investigate the presence of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in patients with primary LV with difficult-to-control ulcers&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Methods</span><p id="par0020" class="elsevierStylePara elsevierViewall">A free and informed consent form was obtained from each participant after evaluation and authorization provided by the UNICAMP Institutional Research Board &#40;CAAE&#58; 48163015&#46;8&#46;0000&#46;5405&#41;&#46; Patients over 18 years of age&#44; with a diagnosis of primary LV undergoing follow-up at UNICAMP Dermatology Outpatient Clinic were included in the study&#44; and volunteers without clinical complaints were included as a control group &#40;UNICAMP students and&#47;or employees&#44; over 18 years of age and not pregnant&#41;&#46; Each participant answered a questionnaire to assess risk exposure for acquiring <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#46; Blood samples were collected from the patients and control individuals using an aseptic technique in tubes containing ethylenediaminetetraacetic acid &#40;EDTA&#41; and in tubes without anticoagulant&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">The laboratory where the analyses were performed follows standards to ensure the quality control described by Pitassi et al&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a> Liquid cultures of blood and blood clot samples &#40;blood clots collected from the tube without anticoagulant&#41; and solid cultures of all liquid cultures were performed as previously described&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#44;7</span></a> DNA was extracted from blood samples&#44; from blood clots&#44; and from the liquid cultures using QIAamp DNA minikit &#40;Qiagen Inc&#46;&#44; USA&#41;&#46; In addition to conventional PCR for the constitutive mammalian gene&#44; GAPDH&#44; genus-specific conventional PCR for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; and species-specific double-amplification &#40;nested&#41; and real-time PCRs for <span class="elsevierStyleItalic">B&#46; henselae</span> were performed&#46; Three controls were added in all procedures&#44; &#40;extraction negative control&#44; PCR-negative control and PCR-positive control &#8210; strain 3715 of <span class="elsevierStyleItalic">B&#46; henselae</span> registered in the Culture Collection Section of Instituto Adolfo Lutz&#41;&#46; Additionally&#44; dilutions of <span class="elsevierStyleItalic">B&#46; henselae</span> were tested in each reaction to determine the sensitivity and the limit of detection of each PCR&#46; All of these methods have been previously described&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#8211;11</span></a> The primers used in the molecular investigation of patients and volunteers are described in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; The obtained amplifications that showed adequate quality for sequencing were sent for similarity comparison with previously deposited material&#46; The flowchart of the performed procedures is shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Results</span><p id="par0030" class="elsevierStylePara elsevierViewall">Sixteen patients with primary LV and 32 individuals without clinical complaints participated in the study&#46; All answered a questionnaire whose data are shown in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#46; It can be observed that the control group was younger &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;001&#41;&#44; with a mean age of 26&#46;71 years&#44; whereas the mean age was 37&#46;62 years among the patients&#46; The control group had more men than the patient group &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;048&#41;&#46; Individuals in this group had more contact with pets &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;007&#41;&#44; were more bitten and&#47;or scratched &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;000&#41;&#44; and were more exposed to arthropods &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;003&#41;&#46; There was no significant difference &#40;<span class="elsevierStyleItalic">p</span>&#160;&#62;&#160;0&#46;05&#41; when comparing these characteristics in those who had <span class="elsevierStyleItalic">Bartonella</span> spp&#46; DNA detected and those who did not&#44; in each of the groups separately&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">The constitutive gene &#40;GAPDH&#41; was detected in all samples from patients and volunteers&#44; guaranteeing the quality of the DNA extracted for the analyses and the absence of inhibitors for the reactions&#44; guaranteeing the quality of the DNA extracted from the samples and the absence of inhibitors for the molecular reactions&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall">In conventional PCR for <span class="elsevierStyleItalic">Bartonella</span> spp&#46;<span class="elsevierStyleItalic">&#44;</span> the limit of detection was 50 genome equivalent &#40;GE&#41; and ten GE in the nested PCR and real-time PCR&#46;</p><p id="par0045" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">B&#46; henselae</span> DNA was detected in four patients in at least one species-specific reaction&#46; In the control group&#44; DNA was detected in four volunteers&#46; Amplified material from six participants out of eight with bacterial DNA detection was sequenced&#44; and all amplified samples showed 99&#37; to 100&#37; of similarity to <span class="elsevierStyleItalic">B&#46; henselae</span> &#40;GenBank accession number&#58; CP020742&#46;1&#41;&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">There was no growth of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in solid cultures from any sample of the 48 participants&#46; There was no statistical significance using Fischer&#8217;s test in the detection of bacterial DNA between the two groups &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;413&#41;&#44; as also observed in <a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">Considering that primary LV is a rare manifestation and using Fisher&#39;s exact test to establish the sample size calculation for the study and setting the significance level at 5&#37; &#40;alpha or type I error&#41; with a sampling power of 80&#37; &#40;beta or type II error of 20&#37;&#41;&#44; based on the obtained data&#44; it can be established that the minimum sample size for the results to have statistical significance would be 106 patients&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Discussion</span><p id="par0060" class="elsevierStylePara elsevierViewall">The authors did not find any studies in the literature reporting infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in LV&#46; As it has been proposed for SARS-CoV-2&#44;<a class="elsevierStyleCrossRef" href="#bib0060"><span class="elsevierStyleSup">12</span></a> it is possible that persistent infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; also causes direct vascular damage or promotes a hypercoagulable state&#46;</p><p id="par0065" class="elsevierStylePara elsevierViewall">It is known that LV is a vaso-occlusive disease with hyalinization and thrombosis of dermal vessels&#44; and many patients complain of pain and paresthesia&#46; All studied patients reported severe pain associated with the presence of ulcers&#44; and most reported paresthesia or mild pain after healing&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> Several articles have associated chronic pain with <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#46;<a class="elsevierStyleCrossRefs" href="#bib0065"><span class="elsevierStyleSup">13&#8211;15</span></a> Translational studies have documented pain hypersensitivity in mice infected with <span class="elsevierStyleItalic">B&#46; henselae</span>&#46;<a class="elsevierStyleCrossRefs" href="#bib0080"><span class="elsevierStyleSup">16&#44;17</span></a> These microorganisms cause intra-endothelial infection and could stimulate endothelin &#40;ET-1&#41; synthesis&#44; a potent vasoconstrictor&#44; which is related to paresthesia and pain&#44; including chronic pain&#46;<a class="elsevierStyleCrossRefs" href="#bib0065"><span class="elsevierStyleSup">13&#44;16&#44;18&#44;19</span></a></p><p id="par0070" class="elsevierStylePara elsevierViewall">It was not possible to detect the DNA of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in three-quarters of the patients&#44; which is not surprising&#44; since LV is a cutaneous manifestation of different diseases&#46; Moreover&#44; <span class="elsevierStyleItalic">B&#46; henselae</span> causes cyclic bacteremia&#44; and the blood samples can be obtained at intervals when the bacteria are not circulating&#46; Different authors have shown that infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; has a greater chance of being diagnosed through a biopsy of tissue fragments than by a blood sample and that the results of this difference may be of greater importance and show statistical significance&#46;<a class="elsevierStyleCrossRefs" href="#bib0095"><span class="elsevierStyleSup">19&#8211;23</span></a> For ethical reasons&#44; only blood samples were collected to minimize damage to the control group volunteers&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">Furthermore&#44; there is no reference diagnostic method for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection and false-negative results are frequent&#44; even when using a platform with molecular and microbiological techniques&#46; The need for multiple tests for adequate detection of this microorganism&#44; aiming at reducing false negative results&#44; has already been discussed by Drummond et al&#46; Molecular techniques are limited by their low sensitivity &#40;minimum of 4&#44;000 copies&#47;mL in the laboratory where the analyses were performed&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Even in diseases with tissue involvement&#44; the identification of the agent in the anatomopathological examination has low sensitivity&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> Historically&#44; silver impregnation stains have been used for the detection of <span class="elsevierStyleItalic">Bartonella</span> species&#59; however&#44; as the stain is non-specific&#44; the reading can be difficult due to the formation of silver precipitates&#46; A study by Caponetti et al&#46; evaluated the use of immunohistochemistry &#40;IHC&#41; for the identification of <span class="elsevierStyleItalic">B&#46; henselae</span> in cat-scratch disease &#40;CSD&#41; in 24 cases of lymphadenitis in formalin-fixed and paraffin-embedded biopsy specimens and compared the results with silver impregnation &#40;SI&#41; and PCR&#46; The positive cases were as follows&#58; SI&#44; 11 &#40;46&#37;&#41;&#59; PCR&#44; nine &#40;38&#37;&#41;&#59; and IHC&#44; six &#40;25&#37;&#41;&#46; Only two cases &#40;8&#37;&#41; were positive for all three studies and SI was more sensitive but less specific&#46; Although 11 &#40;46&#37;&#41; of the study cases were positive using SI&#44; only six of these samples were concurrently positive at the immunohistochemical analysis and&#47;or PCR&#46; This finding suggests that several of the cases interpreted as positive by SI may represent false-positive results and that the diagnostic sensitivity of these three tests is low for CSD&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a> Another study with 106 cases of endocarditis compared the results of immunohistochemistry&#44; Western blotting and real-time PCR in whole blood&#44; serum and valvular tissue&#46; Immunohistochemistry and Warthin-Starry staining were the least sensitive techniques&#46; In this study&#44; Warthin-Starry staining was the more sensitive of these two methods &#40;five samples were positive for Warthin-Starry staining and negative in the immunohistochemical analysis&#41;&#46; However&#44; this histological stain is not specific for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; As the infectious process can be localized&#44; a negative immunohistochemical result does not definitively rule out the diagnosis of endocarditis by <span class="elsevierStyleItalic">Bartonella</span> spp&#46;<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> The isolation of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; is difficult&#44; even under specific and ideal conditions&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">Bacteremia was documented in the index case&#44; through the isolation of the bacteria in a solid medium even after one year of treatment with doxycycline&#44; but no isolation of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; was observed in any of the study participants&#46; The difficulty of treating the infection with antibiotics&#44; as seen in trench fever &#40;caused by <span class="elsevierStyleItalic">Bartonella quintana</span>&#41; and Oroya fever &#40;which is the first manifestation of biphasic Carrion&#39;s disease and can progress to <span class="elsevierStyleItalic">verruga Peruana</span>&#44; caused by <span class="elsevierStyleItalic">Bartonella bacilliformis</span>&#41;&#44; suggest that these bacteria are not eradicated&#46; This potential persistence of the infection makes it impossible to guarantee that manifestations observed in LV are infectious or post-infectious immune reactions&#44; as has been suggested&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">25</span></a></p><p id="par0085" class="elsevierStylePara elsevierViewall">Few research groups perform solid cultures for the isolation of <span class="elsevierStyleItalic">Bartonella</span> spp&#46; This is due to the fact that isolation depends on specific media and prolonged incubation&#46; Additionally&#44; fastidious growth and lack of success in primary isolation make this type of diagnosis unfeasible&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">As LV is the cutaneous manifestation of different diseases&#44; infection by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; could be just one of the causes of this manifestation&#46; Moreover&#44; because it infects endothelial cells and is the only known genus of bacteria to stimulate its proliferation in humans&#44;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> the screening in blood samples may not represent the patient&#39;s actual condition in relation to the infection by these bacteria&#44; as bacteremia is usually cyclical&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">Data collected from the questionnaire regarding the risk factors for bartonellosis &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41; showed that the volunteers in the control group were significantly younger since most of these volunteers consisted of UNICAMP students&#46; LV affects more women and there was a statistical difference between the sex proportion in the groups&#46; One limitation of the study is the fact that the volunteers were more exposed to risk factors for acquiring <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#44; factors that were observed in a study carried out with blood donors from the UNICAMP Blood Bank&#44;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> since they reported&#44; in greater numbers&#44; when compared to the patients&#44; having suffered bites and scratches&#44; contact with pets and exposure to arthropods&#46; Even with lower risk exposure&#44; the group of patients with LV had twice the infection rate&#44; 25&#37; &#40;4&#47;16&#41;&#44; which may indicate that the prevalence of infection by <span class="elsevierStyleItalic">B&#46; henselae</span> in patients is higher and that these bacteria can&#44; in fact&#44; be related to disease onset&#46; Another explanation for not having found a statistically significant difference is the small number of patients in the study that evaluates patients with a rare disease&#44; which was carried out as a pilot study in a single institution&#46; As described in the results&#44; using volunteers with the same characteristics as the controls&#44; would take almost seven times more patients to document statistical significance&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">The lack of a reference diagnostic test&#44; combined with the great difficulty in detecting bacteremia caused by <span class="elsevierStyleItalic">Bartonella</span> spp&#46;&#44; reinforces the need to use diverse and complementary methods to increase the sensitivity and accuracy of the diagnosis&#46; This combination of methods and the testing of different samples makes the laboratory diagnosis more effective and has been used by different research groups&#46;<a class="elsevierStyleCrossRefs" href="#bib0030"><span class="elsevierStyleSup">6&#44;20&#44;28&#8211;30</span></a></p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Conclusion</span><p id="par0105" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">B&#46; henselae</span> DNA was detected in one out of four patients with primary LV&#44; which reinforces the need to investigate <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection in these individuals&#44; although there was no statistical difference between the patient group and the control group&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Financial support</span><p id="par0110" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleGrantSponsor" id="gs1">National Council for Scientific and Technological Development</span> &#40;CNPq&#41; for the scholarships granted&#58; <span class="elsevierStyleGrantNumber" refid="gs1">n&#46; 170501&#47;2018-3</span> &#40;LSS&#41;&#44; <span class="elsevierStyleGrantNumber" refid="gs1">n&#46; 313762&#47;2021-0</span> &#40;PENFV&#41; and <span class="elsevierStyleGrantNumber" refid="gs1">n&#46; 151006&#47;2021-0</span> &#40;MRD&#41;&#46; <span class="elsevierStyleGrantSponsor" id="gs2">S&#227;o Paulo Dermatology Support Fund &#40;Funadersp&#41; &#47; Brazilian Society of Dermatology&#44; Regional S&#227;o Paulo</span> &#40;Fran&#231;a&#44; AFEC&#41;&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Authors&#39; contributions</span><p id="par0115" class="elsevierStylePara elsevierViewall">Marina Rovani Drummond&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">Luciene Silva dos Santos&#58; Approval of the final version of the manuscript&#59; design and planning of the study&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">Lais Bomediano Souza&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the manuscript&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">Gabriela Nero Mitsuushi&#58; Approval of the final version of the manuscript&#59; design and planning of the study&#59; critical review of the literature&#59; participation in patient selection and sample collection&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Maria Let&#237;cia Cintra&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Andrea Fernandes Eloy da Costa Fran&#231;a&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">Elemir Macedo de Souza&#58; Approval of the final version of the manuscript&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p><p id="par0150" class="elsevierStylePara elsevierViewall">Paulo Eduardo Neves Ferreira Velho&#58; Approval of the final version of the manuscript&#59; design and planning of the study&#59; participation in patient selection and sample collection&#59; drafting and editing of the manuscript&#59; critical review of the literature&#59; critical review of the manuscript&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Conflicts of interest</span><p id="par0155" class="elsevierStylePara elsevierViewall">None declared&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres1923542"
          "titulo" => "Abstract"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Objective"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Study limitations"
            ]
            5 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1658949"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:2 [
          "identificador" => "sec0010"
          "titulo" => "Methods"
        ]
        4 => array:2 [
          "identificador" => "sec0015"
          "titulo" => "Results"
        ]
        5 => array:2 [
          "identificador" => "sec0020"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0025"
          "titulo" => "Conclusion"
        ]
        7 => array:2 [
          "identificador" => "sec0030"
          "titulo" => "Financial support"
        ]
        8 => array:2 [
          "identificador" => "sec0035"
          "titulo" => "Authors&#39; contributions"
        ]
        9 => array:2 [
          "identificador" => "sec0040"
          "titulo" => "Conflicts of interest"
        ]
        10 => array:2 [
          "identificador" => "xack673911"
          "titulo" => "Acknowledgments"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2022-05-18"
    "fechaAceptado" => "2022-07-21"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1658949"
          "palabras" => array:3 [
            0 => "Bartonella"
            1 => "Livedoid vasculopathy"
            2 => "Skin ulcer"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Livedoid vasculopathy &#40;LV&#41; manifests as ulcers and atrophic white scars on the lower extremities&#46; The main known etiopathogenesis is hypercoagulability with thrombus formation&#44; followed by inflammation&#46; Thrombophilia&#44; collagen and myeloproliferative diseases may induce LV&#44; but the idiopathic &#40;primary&#41; form predominates&#46; <span class="elsevierStyleItalic">Bartonella</span> spp&#46; may cause intra-endothelial infection and skin manifestations caused by these bacteria may be diverse&#44; including leukocytoclastic vasculitis and ulcers&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Objective</span><p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">The aim of this study was to investigate the presence of bacteremia by <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in patients with difficult-to-control chronic ulcers diagnosed as primary LV&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Questionnaires and molecular tests &#40;conventional PCR&#44; nested PCR and real-time PCR&#41; were applied and liquid and solid cultures were performed in the blood samples and blood clot of 16&#160;LV patients and 32 healthy volunteers&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0065" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Bartonella henselae</span> DNA was detected in 25&#37; of LV patients and in 12&#46;5&#37; of control subjects but failed to reach statistically significant differences &#40;<span class="elsevierStyleItalic">p</span>&#160;&#61;&#160;0&#46;413&#41;&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Study limitations</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Due to the rarity of primary LV&#44; the number of patients studied was small and there was greater exposure of the control group to risk factors for <span class="elsevierStyleItalic">Bartonella</span> spp&#46; infection&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Conclusion</span><p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Although there was no statistically significant difference between the groups&#44; the DNA of <span class="elsevierStyleItalic">B&#46; henselae</span> was detected in one of every four patients&#44; which reinforces the need to investigate <span class="elsevierStyleItalic">Bartonella</span> spp&#46; in patients with primary LV&#46;</p></span>"
        "secciones" => array:6 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Objective"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Study limitations"
          ]
          5 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:2 [
        "etiqueta" => "&#8902;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Study conducted at the Faculty of Medical Sciences&#44; Universidade Estadual de Campinas&#44; S&#227;o Paulo&#44; SP&#44; Brazil&#46;</p>"
      ]
    ]
    "multimedia" => array:7 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2292
            "Ancho" => 1508
            "Tamanyo" => 198676
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Right foot&#44; aspect of the dorsum one year after onset of the condition&#58; mild livedo racemosa&#44; hypochromic atrophic scars with telangiectasias&#44; ulcers with erythematous background&#44; some covered by fibrinopurulent tissue and others by hematic crusts&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 1105
            "Ancho" => 1675
            "Tamanyo" => 210907
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Right foot&#44; aspect of the dorsum&#58; pustules and ulcers with erythematous background&#44; many crusts and concretions&#44; hypochromic atrophic lesions and other hyperchromic ones&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1659
            "Ancho" => 2508
            "Tamanyo" => 1105933
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Chronic ulcer&#58; &#40;A&#41; hyperplastic epidermis at the edge &#40;red arrow&#41;&#44; vessels with hyalinized walls at the edge and in the ulcer bed &#40;black arrows&#41;&#44; inflammatory cell aggregates and fibrosis of the reticular dermis and hypodermis&#59; &#40;B&#41; wall hyalinosis and occlusive thrombosis of the lumen in the dermis and hypodermis vessels &#40;yellow arrows&#41;&#44; with inflammatory exudate containing polymorphonuclear neutrophils&#46; Hematoxylin &#38; eosin&#44; x40 &#40;A&#41; and x100 &#40;B&#41;&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1226
            "Ancho" => 3341
            "Tamanyo" => 211491
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0020"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Flowchart of the procedures performed&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0025"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">&#43;&#44; detected DNA&#59; <span class="elsevierStyleItalic">&#8722;</span>&#44; DNA not detected&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Sample</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Whole blood</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Liquid culture</th><th class="td-with-role" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t ; entry_with_role_colgroup " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Solid culture</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Conventional PCR &#40;ITS&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Nested PCR &#40;<span class="elsevierStyleItalic">fstZ</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Conventional PCR &#40;ITS&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Nested PCR &#40;<span class="elsevierStyleItalic">fstZ</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Conventional PCR &#40;ITS&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Nested PCR &#40;<span class="elsevierStyleItalic">fstZ</span>&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">November&#47;2012 &#40;under antibiotic treatment&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">No growth</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">No growth</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">December&#47;2013 &#40;without antibiotic treatment&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">&#8722;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">&#43;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Results of molecular investigations in the index case of primary livedoid vasculopathy with bacteremia confirmed by <span class="elsevierStyleItalic">Bartonella henselae&#46;</span></p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0030"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">PCR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence of nucleotides &#40;5&#39;-3&#39;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Molecular target&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Conventional<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCTTCATTGACCTCAACTACAT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCAAACTTGTCATGGATGACC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Conventional<a class="elsevierStyleCrossRef" href="#bib0050"><span class="elsevierStyleSup">10</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ITS F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTCAGATGATGATCCCAAGCCTTYTGGCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ITS</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ITS R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAACCGACGACCCCCTGCTTGCAAAGCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Double amplification &#40;nested&#41;<a class="elsevierStyleCrossRef" href="#bib0055"><span class="elsevierStyleSup">11</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCCGCAAAGTTCTTTTCATG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">ftsZ</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGGTGAACGCGCTTGTATTTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH S&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAAAACGGTTGGAGAGCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">BH A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGCCTGTCATCTCATCAAGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Real-time<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a></td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CS F&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ATGGGTTTTGGTCATCGAGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowgroup " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">gltA</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CS R&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AAATCGACATTAGGGTAAAGTTTTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Primers used in the molecular investigation of the patient and control groups&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0035"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">p</span>-values shown in <span class="elsevierStyleBold">bold</span> in the tables are statistically significant&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Control &#40;n&#160;&#61;&#160;32&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Livedoid vasculopathy &#40;n&#160;&#61;&#160;16&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Total &#40;n&#160;&#61;&#160;48&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#40;Mean&#160;&#177;&#160;SD&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#46;71&#160;&#177;&#160;8&#46;57&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">37&#46;62&#160;&#177;&#160;9&#46;76&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30&#46;35&#160;&#177;&#160;10&#46;29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;001</span><a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age &#40;Median &#40;min&#8210;max&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23&#46;00 &#40;18&#46;0&#8211;51&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">39&#46;50 &#40;15&#46;0&#8211;51&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&#46;50 &#40;15&#46;0&#8211;51&#46;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;39&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;29&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">33 &#40;68&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;048</span><a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">c</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;27&#46;1&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;4&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">15 &#40;31&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Contact with housepets&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;10&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;19&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;29&#46;8&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;007</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26 &#40;55&#46;3&#37;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;14&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">33 &#40;70&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">31 &#40;66&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;34&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Contact with wild animals&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;286<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;58&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">44 &#40;91&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Bite or Scratch&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24 &#40;50&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27 &#40;56&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;000</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;14&#46;6&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13 &#40;27&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;41&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Missing&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;2&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;2&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Exposure to arthropods&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29 &#40;60&#46;4&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;16&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">37 &#40;77&#46;1&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">0&#46;003</span><a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;6&#46;2&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;16&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11 &#40;22&#46;9&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Detection of <span class="elsevierStyleItalic">Bartonella henselae</span> DNA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Yes&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;35&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;16&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;413<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">No&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;58&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12 &#40;25&#46;0&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40 &#40;83&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Total&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;66&#46;7&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">16 &#40;33&#46;3&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
          "notaPie" => array:3 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "a"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Mann-Whitney test&#46;</p>"
            ]
            1 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "b"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Fisher&#8217;s test&#46;</p>"
            ]
            2 => array:3 [
              "identificador" => "tblfn0015"
              "etiqueta" => "c"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Chi-square test&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Comparison between the control group and the group of patients with livedoid vasculopathy&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:30 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Livedoid vasculopathy&#58; an intringuing cutaneous disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;R&#46; Criado"
                            1 => "E&#46;A&#46; Rivitti"
                            2 => "M&#46;N&#46; Sotto"
                            3 => "N&#46;Y&#46; Sakai Valente"
                            4 => "V&#46; Aoki"
                            5 => "J&#46;F&#46; de Carvalho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/s0365-05962011000500015"
                      "Revista" => array:6 [
                        "tituloSerie" => "An Bras Dermatol&#46;"
                        "fecha" => "2011"
                        "volumen" => "86"
                        "paginaInicial" => "961"
                        "paginaFinal" => "977"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22147037"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Livedoid vasculopathy&#58; review of pathogenesis&#44; clinical presentation&#44; diagnostic workup&#44; and treatment"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G&#46;T&#46; Haunson"
                            1 => "D&#46;W&#46; Judy"
                            2 => "N&#46;C&#46; Prall"
                            3 => "R&#46;A&#46; Mille"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "Cutis&#46;"
                        "fecha" => "2012"
                        "volumen" => "90"
                        "paginaInicial" => "302"
                        "paginaFinal" => "306"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23409480"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1074761321001175"
                          "estado" => "S300"
                          "issn" => "10747613"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonellosis&#44; One Health and all creatures great and small"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "E&#46;B&#46; Breitschwerdt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Vet Dermatol&#46;"
                        "fecha" => "2017"
                        "volumen" => "28"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cutaneous manifestations of bartonellosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "K&#46;A&#46; Lins"
                            1 => "M&#46;R&#46; Drummond"
                            2 => "P&#46;E&#46;N&#46;F&#46; Velho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.abd.2019.09.024"
                      "Revista" => array:6 [
                        "tituloSerie" => "An Bras Dermatol&#46;"
                        "fecha" => "2019"
                        "volumen" => "94"
                        "paginaInicial" => "594"
                        "paginaFinal" => "602"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31780437"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella spp&#46; bacteremia in blood donors from Campinas"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46;H&#46; Pitassi"
                            1 => "P&#46;P&#46; de Paiva Diniz"
                            2 => "D&#46;G&#46; Scorpio"
                            3 => "M&#46;R&#46; Drummond"
                            4 => "B&#46;G&#46; Lania"
                            5 => "M&#46;L&#46; Barjas-Castro"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Brazil&#46; PLoS Negl Trop Dis&#46;"
                        "fecha" => "2015"
                        "volumen" => "9"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Improvement of Bartonella henselae DNA detection in cat blood samples by combining molecular and culture methods"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;R&#46; Drummond"
                            1 => "B&#46;G&#46; Lania"
                            2 => "P&#46;P&#46;V&#46;P&#46; Diniz"
                            3 => "R&#46; Gilioli"
                            4 => "D&#46;M&#46;R&#46; Demolin"
                            5 => "D&#46;G&#46; Scorpio"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.01732-17"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2018"
                        "volumen" => "56"
                        "paginaInicial" => "e01732"
                        "paginaFinal" => "17"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29540455"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae bacteremia diagnosed post-mortem in a myelodysplastic syndrome patient"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;R&#46; Drummond"
                            1 => "L&#46; Visentainer"
                            2 => "A&#46;R&#46; Almeida"
                            3 => "R&#46;N&#46; Angerami"
                            4 => "F&#46;H&#46; Aoki"
                            5 => "P&#46;E&#46;N&#46;F&#46; Velho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/S1678-9946201961050"
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2019"
                        "volumen" => "61"
                        "paginaInicial" => "e50"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31531628"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Multiplex SYBR&#174; green-real time PCR &#40;qPCR&#41; assay for the detection and differentiation of Bartonella henselae and Bartonella clarridgeiae in cats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46; Staggemeier"
                            1 => "D&#46;A&#46; Pilger"
                            2 => "F&#46;R&#46; Spilki"
                            3 => "V&#46;V&#46; Cantarelli"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2014"
                        "volumen" => "56"
                        "paginaInicial" => "93"
                        "paginaFinal" => "95"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni &#40;Asian genotype&#41; and B&#46; canis DNA in canine blood samples"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46;J&#46; Birkenheuer"
                            1 => "M&#46;G&#46; Levy"
                            2 => "E&#46;B&#46; Breitschwerdt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/JCM.41.9.4172-4177.2003"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2003"
                        "volumen" => "41"
                        "paginaInicial" => "4172"
                        "paginaFinal" => "4177"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12958243"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1473309920302346"
                          "estado" => "S300"
                          "issn" => "14733099"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Canine bartonellosis&#58; serological and molecular prevalence in Brazil and evidence of co-infection with Bartonella henselae and Bartonella vinsonii subsp&#46; berkhoffii"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;P&#46;V&#46;P&#46; Diniz"
                            1 => "R&#46;G&#46; Maggi"
                            2 => "D&#46;S&#46; Schwartz"
                            3 => "M&#46;B&#46; Cadenas"
                            4 => "J&#46;M&#46; Bradley"
                            5 => "B&#46; Hegarty"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Vet Res&#46;"
                        "fecha" => "2007"
                        "volumen" => "38"
                        "paginaInicial" => "697"
                        "paginaFinal" => "710"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Detection of Bartonella henselae DNA in clinical samples including peripheral blood of immune competent and immune compromised patients by three nested amplifications"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "K&#46;H&#46; Kawasato"
                            1 => "L&#46;C&#46; de Oliveira"
                            2 => "P&#46;E&#46; Velho"
                            3 => "L&#46; Yamamoto"
                            4 => "G&#46;M&#46;B&#46; Del Negro"
                            5 => "T&#46;S&#46; Okay"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/s0036-46652013000100001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2013"
                        "volumen" => "55"
                        "paginaInicial" => "1"
                        "paginaFinal" => "6"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23328718"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cutaneous manifestations of SARS-CoV-2 infection&#58; a clinical update"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "P&#46; Gisondi"
                            1 => "S&#46; PIaserico"
                            2 => "C&#46; Bordin"
                            3 => "M&#46; Alaibac"
                            4 => "G&#46; Girolomoni"
                            5 => "L&#46; Naldi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jdv.16774"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Eur Acad Dermatol Venereol&#46;"
                        "fecha" => "2020"
                        "volumen" => "34"
                        "paginaInicial" => "2499"
                        "paginaFinal" => "2504"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32585074"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0161642011007895"
                          "estado" => "S300"
                          "issn" => "01616420"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Unknown fever and back pain caused by Bartonella henselae in a veterinarian after a needle puncture&#58; a case report and literature review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;W&#46; Lin"
                            1 => "C&#46;M&#46; Chen"
                            2 => "C&#46;C&#46; Chang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Vector Borne Zoonotic Dis&#46;"
                        "fecha" => "2011"
                        "volumen" => "11"
                        "paginaInicial" => "589"
                        "paginaFinal" => "591"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chronic Bartonella quintana bacteremia in homeless patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "P&#46; Brouqui"
                            1 => "B&#46; Lascola"
                            2 => "V&#46; Roux"
                            3 => "D&#46; Raoult"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1056/NEJM199901213400303"
                      "Revista" => array:6 [
                        "tituloSerie" => "N Engl J Med&#46;"
                        "fecha" => "1999"
                        "volumen" => "340"
                        "paginaInicial" => "184"
                        "paginaFinal" => "189"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9895398"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infections in an owner and two Papillon dogs exposed to tropical rat mites &#40;Ornithonyssus bacoti&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "J&#46;M&#46; Bradley"
                            1 => "P&#46;E&#46; Mascarelli"
                            2 => "C&#46;L&#46; Trull"
                            3 => "R&#46;G&#46; Maggi"
                            4 => "E&#46;B&#46; Breitschwerdt"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/vbz.2013.1492"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vector Borne Zoonotic Dis&#46;"
                        "fecha" => "2014"
                        "volumen" => "14"
                        "paginaInicial" => "703"
                        "paginaFinal" => "709"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25325313"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infection induces persistent mechanical hypersensitivity in mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Vieira-Damiani"
                            1 => "A&#46;R&#46; Almeida"
                            2 => "M&#46;N&#46; Silva"
                            3 => "B&#46;G&#46; Lania"
                            4 => "T&#46;C&#46;B&#46; Soares"
                            5 => "M&#46;R&#46; Drummond"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/S1678-9946202062079"
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Inst Med Trop Sao Paulo&#46;"
                        "fecha" => "2020"
                        "volumen" => "62"
                        "paginaInicial" => "e79"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33146308"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infection in sickle cell disease mice is associated with hyperalgesia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;R&#46; de Almeida"
                            1 => "G&#46; Vieira-Damiani"
                            2 => "M&#46;N&#46; da Silva"
                            3 => "B&#46;G&#46; Lania"
                            4 => "T&#46;C&#46;B&#46; Soares"
                            5 => "M&#46;R&#46; Drummond"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/vbz.2018.2331"
                      "Revista" => array:6 [
                        "tituloSerie" => "Vector Borne Zoonotic Dis&#46;"
                        "fecha" => "2019"
                        "volumen" => "19"
                        "paginaInicial" => "102"
                        "paginaFinal" => "105"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30272535"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Activation of hypoxia-inducible factor-1 in bacillary angiomatosis&#58; evidence for a role of hypoxia-inducible factor-1 in bacterial infections"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "V&#46;A&#46; Kempf"
                            1 => "M&#46; Lebiedziejewski"
                            2 => "K&#46; Alitalo"
                            3 => "J&#46;H&#46; W&#228;lzlein"
                            4 => "U&#46; Ehehalt"
                            5 => "J&#46; Fiebig"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Circulation&#46;"
                        "fecha" => "2005"
                        "volumen" => "111"
                        "paginaInicial" => "1054"
                        "paginaFinal" => "1062"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A novel potent vasoconstrictor peptide produced by vascular endothelial cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Yanagisawa"
                            1 => "H&#46; Kurihara"
                            2 => "S&#46; Kimura"
                            3 => "Y&#46; Tomobe"
                            4 => "M&#46; Kobayashi"
                            5 => "Y&#46; Mitsui"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/332411a0"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nature&#46;"
                        "fecha" => "1988"
                        "volumen" => "332"
                        "paginaInicial" => "411"
                        "paginaFinal" => "415"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2451132"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella&#44; a common cause of endocarditis&#58; a report on 106 cases and review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Edouard"
                            1 => "C&#46; Nabet"
                            2 => "H&#46; Lepidi"
                            3 => "P&#46;E&#46; Fournier"
                            4 => "D&#46; Raoult"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Microbiol&#46;"
                        "fecha" => "2015"
                        "volumen" => "53"
                        "paginaInicial" => "824"
                        "paginaFinal" => "829"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella vinsonii subsp&#46; arupensis infection in animals of veterinary importance&#44; ticks and biopsy samples"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "D&#46; Chochlakis"
                            1 => "S&#46; Cutler"
                            2 => "N&#46;D&#46; Giadinis"
                            3 => "A&#46; Psaroulaki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "New Microbes New Infect&#46;"
                        "fecha" => "2020"
                        "volumen" => "34"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Paraffin-embedded tissue&#58; an alternative to Bartonella sp&#46; infection diagnosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "L&#46; Silva Dos Santos"
                            1 => "M&#46;R&#46; Drummond"
                            2 => "E&#46;C&#46; Fran&#231;a"
                            3 => "M&#46;L&#46; Cintra"
                            4 => "P&#46;E&#46;N&#46;F&#46; Velho"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/ddg.13607"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Dtsch Dermatol Ges&#46;"
                        "fecha" => "2018"
                        "volumen" => "16"
                        "paginaInicial" => "1147"
                        "paginaFinal" => "1148"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24251729"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S1888429616000212"
                          "estado" => "S300"
                          "issn" => "18884296"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular diagnosis of skin infections using paraffin-embedded tissue - review and interdisciplinary consensus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Sunderk&#246;tter"
                            1 => "K&#46; Becker"
                            2 => "H&#46; Kutzner"
                            3 => "T&#46; Meyer"
                            4 => "N&#46; Bl&#246;dorn-Schlicht"
                            5 => "U&#46; Reischl"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/ddg.13438_g"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Dtsch Dermatol Ges&#46;"
                        "fecha" => "2018"
                        "volumen" => "16"
                        "paginaInicial" => "139"
                        "paginaFinal" => "147"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29418100"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of immunohistochemistry in identifying Bartonella henselae in cat-scratch disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "G&#46;C&#46; Caponetti"
                            1 => "L&#46; Pantanowitz"
                            2 => "S&#46; Marconi"
                            3 => "J&#46;M&#46; Havens"
                            4 => "L&#46;W&#46; Lamps"
                            5 => "C&#46;N&#46; Otis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1309/AJCPMNULMO9GPLYU"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Clin Pathol&#46;"
                        "fecha" => "2009"
                        "volumen" => "131"
                        "paginaInicial" => "250"
                        "paginaFinal" => "256"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19141385"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella henselae infection-associated vasculitis and crescentic glomerulonephritis leading to renal allograft loss"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "A&#46;R&#46; Chaudhry"
                            1 => "M&#46;R&#46; Chaudhry"
                            2 => "J&#46;C&#46; Papadimitriou"
                            3 => "C&#46;B&#46; Drachenberg"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/tid.12376"
                      "Revista" => array:7 [
                        "tituloSerie" => "Transpl Infect Dis&#46;"
                        "fecha" => "2015"
                        "volumen" => "17"
                        "paginaInicial" => "411"
                        "paginaFinal" => "417"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25753276"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0163445321000360"
                          "estado" => "S300"
                          "issn" => "01634453"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella-associated endothelial proliferation depends on inhibition of apoptosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;E&#46; Kirby"
                            1 => "D&#46;M&#46; Nekorchuk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1073/pnas.072292699"
                      "Revista" => array:6 [
                        "tituloSerie" => "Proc Natl Acad Sci U S A&#46;"
                        "fecha" => "2002"
                        "volumen" => "99"
                        "paginaInicial" => "4656"
                        "paginaFinal" => "4661"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11904386"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Risk Factors for Bartonella species Infection in Blood Donors from Southeast Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "P&#46;P&#46; Diniz"
                            1 => "P&#46;E&#46; Velho"
                            2 => "L&#46;H&#46; Pitassi"
                            3 => "M&#46;R&#46; Drummond"
                            4 => "B&#46;G&#46; Lania"
                            5 => "M&#46;L&#46; Barjas-Castro"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "PLoS Negl Trop Dis&#46;"
                        "fecha" => "2016"
                        "volumen" => "10"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Testing for Bartonella ssp&#46; DNA in cerebrospinal fluid of dogs with inflammatory central nervous system disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46; Bartner"
                            1 => "S&#46; McGrath"
                            2 => "A&#46; Drury"
                            3 => "A&#46;V&#46; Chen"
                            4 => "A&#46; Morris"
                            5 => "M&#46; Brewer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/jvim.15288"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Vet Intern Med&#46;"
                        "fecha" => "2018"
                        "volumen" => "32"
                        "paginaInicial" => "1983"
                        "paginaFinal" => "1988"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30381844"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prospective serological and molecular cross-sectional study focusing on Bartonella and other blood-borne organisms in cats from Catalonia &#40;Spain&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46; &#193;lvarez-Fern&#225;ndez"
                            1 => "R&#46; Maggi"
                            2 => "G&#46;E&#46; Mart&#237;n-Valls"
                            3 => "M&#46; Baxarias"
                            4 => "E&#46;B&#46; Breitschwerdt"
                            5 => "L&#46; Solano-Gallego"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s13071-021-05105-6"
                      "Revista" => array:5 [
                        "tituloSerie" => "Parasites Vectors&#46;"
                        "fecha" => "2022"
                        "volumen" => "15"
                        "paginaInicial" => "6"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34983610"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bartonella spp&#46; bacteremia in high-risk immunocompetent patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "R&#46;G&#46; Maggi"
                            1 => "P&#46;E&#46; Mascarelli"
                            2 => "E&#46;L&#46; Pultorak"
                            3 => "B&#46;C&#46; Hegarty"
                            4 => "J&#46;M&#46; Bradley"
                            5 => "B&#46;R&#46; Mozayeni"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.diagmicrobio.2011.09.001"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diagn Microbiol Infect Dis&#46;"
                        "fecha" => "2011"
                        "volumen" => "71"
                        "paginaInicial" => "430"
                        "paginaFinal" => "437"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21996096"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack673911"
        "titulo" => "Acknowledgments"
        "texto" => "<p id="par0160" class="elsevierStylePara elsevierViewall">The authors would like to thank the S&#227;o Paulo State Dermatology Support Fund - Sebasti&#227;o Sampaio &#40;Funadersp&#41; for the research funding granted to carry out this research&#46; They also thank the National Council for Scientific and Technological Development &#40;<span class="elsevierStyleItalic">Conselho Nacional de Desenvolvimento Cient&#237;fico e Tecnol&#243;gico</span>&#41; for the scholarships granted&#58; n&#46; 170501&#47;2018-3 &#40;LSS&#41;&#44; n&#46; 313762&#47;2021-0 &#40;PENFV&#41; and n&#46; 151006&#47;2021-0 &#40;MRD&#41;&#46; The sponsors did not have any influence in the study design&#44; data collection and analysis&#44; publication decision&#44; or manuscript preparation&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03650596/0000009800000004/v1_202307031010/S0365059623000661/v1_202307031010/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "89516"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Article"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03650596/0000009800000004/v1_202307031010/S0365059623000661/v1_202307031010/en/main.pdf?idApp=UINPBA00008Z&text.app=https://clinics.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059623000661?idApp=UINPBA00008Z"
]
Informação do artigo
ISSN: 03650596
Idioma original: Inglês
Dados atualizados diariamente
Ano/Mês Html Pdf Total
2024 Novembro 36 5 41
2024 Outubro 152 78 230
2024 Setembro 186 106 292
2024 Agosto 188 149 337
2024 Julho 174 119 293
2024 Junho 128 95 223
2024 Maio 93 71 164
2024 Abril 103 94 197
2024 Março 81 73 154
2024 Fevereiro 91 80 171
2024 Janeiro 70 56 126
2023 Dezembro 73 56 129
2023 Novembro 89 93 182
2023 Outubro 77 84 161
2023 Setembro 84 87 171
2023 Agosto 91 48 139
2023 Julho 210 72 282
2023 Junho 74 41 115
2023 Maio 58 44 102
2023 Abril 44 42 86
2023 Março 10 7 17
Mostrar tudo

Siga este link para acessar o texto completo do artigo

Idiomas
Anais Brasileiros de Dermatologia (Portuguese)
en pt
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.