array:23 [
  "pii" => "S0365059622002227"
  "issn" => "03650596"
  "doi" => "10.1016/j.abd.2021.12.007"
  "estado" => "S300"
  "fechaPublicacion" => "2023-01-01"
  "aid" => "634"
  "copyright" => "Sociedade Brasileira de Dermatologia"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "pt" => array:19 [
      "pii" => "S2666275222002375"
      "issn" => "26662752"
      "doi" => "10.1016/j.abdp.2022.10.003"
      "estado" => "S300"
      "fechaPublicacion" => "2023-01-01"
      "aid" => "634"
      "copyright" => "Sociedade Brasileira de Dermatologia"
      "documento" => "article"
      "crossmark" => 1
      "licencia" => "http://creativecommons.org/licenses/by/4.0/"
      "subdocumento" => "fla"
      "abierto" => array:3 [
        "ES" => true
        "ES2" => true
        "LATM" => true
      ]
      "gratuito" => true
      "lecturas" => array:1 [
        "total" => 0
      ]
      "pt" => array:12 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Artigo original</span>"
        "titulo" => "Sub&#8208;regula&#231;&#227;o do miR&#8208;181a atenua o estresse oxidativo induzido por H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> e a senesc&#234;ncia celular atuando sobre PDIA6 em fibroblastos do prep&#250;cio humano"
        "tienePdf" => "pt"
        "tieneTextoCompleto" => "pt"
        "tieneResumen" => "pt"
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "17"
            "paginaFinal" => "25"
          ]
        ]
        "contieneResumen" => array:1 [
          "pt" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "pt" => true
        ]
        "contienePdf" => array:1 [
          "pt" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0015"
            "etiqueta" => "Figura 3"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr3.jpeg"
                "Alto" => 4175
                "Ancho" => 2773
                "Tamanyo" => 733021
              ]
            ]
            "descripcion" => array:1 [
              "pt" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">O <span class="elsevierStyleItalic">knockdown</span> de PDIA6 reverte o impacto supressivo mediado pelo inibidor de miR&#8208;181a na senesc&#234;ncia celular e no estresse oxidativo&#46; &#40;A&#41; An&#225;lise de RT&#8208;qPCR da express&#227;o de PDIA6 em FPH transfectados com sh&#8208;PDIA6&#46; &#40;B&#8211;C&#41; <span class="elsevierStyleItalic">Western blotting</span> da express&#227;o da prote&#237;na PDIA6 em FPH transfectados&#46; &#40;D&#41; Ensaio CCK&#8208;8 para avaliar a viabilidade de FPH com transfec&#231;&#227;o de inibidor de miR&#8208;181a&#44; inibidor de miR&#8208;181a<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>sh&#8208;PDIA6 ou miR&#8208;NC&#46; &#40;E&#8211;F&#41; Colora&#231;&#227;o para SA&#8208;&#946;&#8208;gal para avaliar a porcentagem de c&#233;lulas de FPH positivas para SA&#8208;&#946;&#8208;gal com a transfec&#231;&#227;o acima&#46; As imagens das c&#233;lulas foram fotografadas com aumento de 50<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>&#46; &#40;G&#8211;J&#41;&#44; <span class="elsevierStyleItalic">Western blotting</span> para detectar a concentra&#231;&#227;o de marcadores de senesc&#234;ncia em FPH com a transfec&#231;&#227;o acima&#46; &#40;K&#8211;M&#41;&#44; Mensura&#231;&#227;o das atividades de SOD&#44; GPx e CAT em FPH transfectados com inibidor de miR&#8208;181a&#44; inibidor de miR&#8208;181a<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>sh&#8208;PDIA6 ou miR&#8208;NC&#46; &#42;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;05&#44; &#42;&#42;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;01&#44; &#42;&#42;&#42;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;001&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Yan Huang, Huimin Yan, Yanqing Yang, Jinfei Zhou, Qijun Xu, Meng Hu"
            "autores" => array:6 [
              0 => array:2 [
                "nombre" => "Yan"
                "apellidos" => "Huang"
              ]
              1 => array:2 [
                "nombre" => "Huimin"
                "apellidos" => "Yan"
              ]
              2 => array:2 [
                "nombre" => "Yanqing"
                "apellidos" => "Yang"
              ]
              3 => array:2 [
                "nombre" => "Jinfei"
                "apellidos" => "Zhou"
              ]
              4 => array:2 [
                "nombre" => "Qijun"
                "apellidos" => "Xu"
              ]
              5 => array:2 [
                "nombre" => "Meng"
                "apellidos" => "Hu"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "pt"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S0365059622002227"
          "doi" => "10.1016/j.abd.2021.12.007"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002227?idApp=UINPBA00008Z"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275222002375?idApp=UINPBA00008Z"
      "url" => "/26662752/0000009800000001/v1_202301090939/S2666275222002375/v1_202301090939/pt/main.assets"
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S0365059622002203"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2021.12.005"
    "estado" => "S300"
    "fechaPublicacion" => "2023-01-01"
    "aid" => "632"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Inhibition of ANGPT2 activates autophagy during hypertrophic scar formation via PI3K&#47;AKT&#47;mTOR pathway"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "26"
          "paginaFinal" => "35"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0020"
          "etiqueta" => "Figure 4"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr4.jpeg"
              "Alto" => 4171
              "Ancho" => 3341
              "Tamanyo" => 876100
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0020"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">The effects of ANGPT2 knockdown on the proliferation and migration of HSFs as well as ECM accumulation&#46;</span> &#40;A&#41; CCK-8 assay was conducted to examine the proliferation of HSFs in Blank&#44; sh-NC&#44; sh-ANGPT2&#44; and sh-ANGPT2&#43;MHY1485 groups&#46; &#40;B&#8210;C&#41; Transwell assay was applied to assess the migration of HSFs in the above four groups&#46; &#40;D&#41; Levels of migration-related proteins in the above four groups were measured by western blotting&#46; &#40;E&#41; Western blotting was carried out to evaluate the expression of ECM-related proteins in the above four groups&#46; &#42;p&#160;&#60;&#160;0&#46;05&#44; &#42;&#42;p&#160;&#60;&#160;0&#46;01&#44; &#42;&#42;&#42;p&#160;&#60;&#160;0&#46;001&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Hongxin Chen, Kai Xu, Chao Sun, Si Gui, Juanjuan Wu, Song Wang"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Hongxin"
              "apellidos" => "Chen"
            ]
            1 => array:2 [
              "nombre" => "Kai"
              "apellidos" => "Xu"
            ]
            2 => array:2 [
              "nombre" => "Chao"
              "apellidos" => "Sun"
            ]
            3 => array:2 [
              "nombre" => "Si"
              "apellidos" => "Gui"
            ]
            4 => array:2 [
              "nombre" => "Juanjuan"
              "apellidos" => "Wu"
            ]
            5 => array:2 [
              "nombre" => "Song"
              "apellidos" => "Wang"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275222002351"
        "doi" => "10.1016/j.abdp.2022.10.001"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275222002351?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002203?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000001/v2_202304080751/S0365059622002203/v2_202304080751/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S0365059622002471"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2022.01.012"
    "estado" => "S300"
    "fechaPublicacion" => "2023-01-01"
    "aid" => "659"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Analysis of the autoimmune response to BP180 in Chinese stroke patients"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "13"
          "paginaFinal" => "16"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1417
              "Ancho" => 2175
              "Tamanyo" => 149167
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0030"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">ELISA results in the stroke and control groups&#46; Dots indicate the index value of each sample&#46; &#40;A&#41; Anti-BP180 antibody values of 1183 stroke patients and 855 controls&#46; The dotted lines represent the cutoff value of 20 RU&#47;mL&#46; &#40;B&#41; Anti-BP180 antibody-positive values of 148 stroke patients and 40 controls&#46; Black lines represent the median&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Jing Wang, Hong Liu, Zhenzhen Wang, Qing Pan, Furen Zhang"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Jing"
              "apellidos" => "Wang"
            ]
            1 => array:2 [
              "nombre" => "Hong"
              "apellidos" => "Liu"
            ]
            2 => array:2 [
              "nombre" => "Zhenzhen"
              "apellidos" => "Wang"
            ]
            3 => array:2 [
              "nombre" => "Qing"
              "apellidos" => "Pan"
            ]
            4 => array:2 [
              "nombre" => "Furen"
              "apellidos" => "Zhang"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275222002612"
        "doi" => "10.1016/j.abdp.2022.11.022"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275222002612?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002471?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000001/v2_202304080751/S0365059622002471/v2_202304080751/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence by targeting PDIA6 in human foreskin fibroblasts"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "17"
        "paginaFinal" => "25"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Yan Huang, Huimin Yan, Yanqing Yang, Jinfei Zhou, Qijun Xu, Hu Meng"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Yan"
            "apellidos" => "Huang"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Huimin"
            "apellidos" => "Yan"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Yanqing"
            "apellidos" => "Yang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Jinfei"
            "apellidos" => "Zhou"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Qijun"
            "apellidos" => "Xu"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "Hu"
            "apellidos" => "Meng"
            "email" => array:1 [
              0 => "humeng7622@163.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Wuhan Third Hospital&#44; Department of Plastic Surgery&#44; Hubei&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Xiangyang Yilaimei Medical Beauty Clinic&#44; Department of Aesthetic Dermatology&#44; Hubei&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 4175
            "Ancho" => 2773
            "Tamanyo" => 678384
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0110"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">PDIA6 knockdown reverses miR-181a inhibitor-mediated suppressive impact on cellular senescence and oxidative stress&#46;</span> &#40;A&#41; RT-qPCR analysis of PDIA6 expression in sh-PDIA6-transfected HFF&#46; &#40;B&#8210;C&#41; Western blotting of PDIA6 protein expression in transfected HFF&#46; &#40;D&#41; CCK-8 assay for evaluating the viability of HFF with transfection of miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#40;E&#8210;F&#41; SA-&#946;-gal staining for assessing the percentage of SA-&#946;-gal positive cells of HFF with above transfection&#46; Cell pictures were imaged at 50&#215; magnification&#46; &#40;G&#8210;J&#41; Western blotting for detecting concentration of senescence markers in HFF with above transfection&#46; &#40;K&#8210;M&#41; Measurement of the activities of SOD&#44; GPx and CAT in HFF transfected with miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#42;p &#60; 0&#46;05&#44; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Cellular senescence is a process comprised of irreversible growth arrest which is regarded as one of the hallmarks of aging&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> Cellular senescence in the skin leads to skin aging which can be induced by both extrinsic and intrinsic factors&#46;<a class="elsevierStyleCrossRefs" href="#bib0010"><span class="elsevierStyleSup">2&#44;3</span></a> Senescent cells can be detected with many hallmarks&#44; such as enhanced activity of senescence-associated &#946;-galactosidase &#40;SA-&#946;-gal&#41;&#44; elevated levels of tumor suppressor p53&#44; cyclin-dependent kinase &#40;CDK&#41; inhibitor p21 and senescence marker protein 30 &#40;SMP30&#41;&#46;<a class="elsevierStyleCrossRefs" href="#bib0020"><span class="elsevierStyleSup">4&#44;5</span></a> Numerous studies have indicated that oxidative stress contributes to skin aging and dermal damage&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Oxidative stress is a physiological process resulting from reactive oxygen &#40;ROS&#41; or nitrogen species&#44; including hydrogen peroxide &#40;H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#41; and superoxide anion &#40;O<span class="elsevierStyleSup">2&#8722;</span>&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> The skin has an antioxidative defense system&#44; including the enzymatic antioxidants like superoxide dismutase &#40;SOD&#41;&#44; glutathione peroxidase &#40;GPx&#41;&#44; and catalase &#40;CAT&#41;&#44; which helps to eliminate excessive ROS&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> SOD converts O<span class="elsevierStyleSup">2&#8722;</span> into H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2&#44;</span> while GPx and CAT convert H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> into water&#46;<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9&#44;10</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">It has been elucidated that microRNAs &#40;miRNAs&#41;&#44; endogenous noncoding RNAs of 18&#8211;24 nucleotides&#44; are implicated in a variety of biological processes&#46;<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11&#44;12</span></a> MiRNAs can bind to messenger RNA &#40;mRNA&#41; 3&#8217; untranslated regions &#40;3&#8217;UTRs&#41; and regulate gene expression post-transcriptionally&#46;<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a> Multiple miRNAs have been indicated to play an important role in cellular senescence in the skin&#46; For example&#44; miR-217 facilitates senescence in human skin fibroblasts by binding to DNMT1&#46;<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a> MiR-20a-3p is overexpressed in senescent fibroblasts and leads to cellular senescence by targeting HAS2&#46;<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> Importantly&#44; miR-181a was also demonstrated to be involved in cellular senescence&#46; For example&#44; miR-181a is upregulated during the senescence of human dermal fibroblasts which subsequently induces cellular senescence in early-passage cells&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> Furthermore&#44; downregulated miR-181a was shown to attenuate oxidative stress in myocardial injury by interacting with XIAP&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> Nevertheless&#44; the potential mechanism of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence is unclear&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">Protein disulfide isomerase family A member 6 &#40;PDIA6&#44; also known as P5&#41; catalyzes protein folding and displays isomerase and chaperone activities&#46; <a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> Intriguingly&#44; a previous study demonstrated that PDIA6 is downregulated during cellular senescence in BMSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> In addition&#44; PDIA6&#44; localized in mitochondria&#44; was shown to inhibit cell death caused by oxidative stress&#46;<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> However&#44; whether PDIA6 exerts an effect on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence in human foreskin fibroblasts &#40;HFF&#41; is unknown&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">In this study&#44; the authors intended to explore the role and mechanism of miR-181a underlying H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF&#46; The results might help to develop a new perspective for ameliorating skin aging&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Cell culture</span><p id="par0025" class="elsevierStylePara elsevierViewall">HFF obtained from the cell bank of the chinese academy of sciences &#40;Shanghai&#44; China&#41; were incubated in Dulbecco&#39;s modified Eagle&#8217;s medium &#40;DMEM&#44; Invitrogen&#44; Carlsbad&#44; CA&#44; USA&#41; containing 10&#37; fetal bovine serum &#40;Gibco&#44; Grand Island&#44; NY&#44; USA&#41; and 1&#37; sodium pyruvate &#40;Invitrogen&#41; in a humidified incubator with at 37 &#176;C with 5&#37; CO<span class="elsevierStyleInf">2</span>&#46; After being grown to 80&#37; confluence&#44; cells in the logarithmic phase of growth were inoculated into 96-well plates &#40;10<span class="elsevierStyleSup">4</span> cells&#47;well&#41; and further cultured for 24 h&#46; Then&#44; the culture medium was removed and replaced with DMEM containing 1&#37; FBS&#46; After 24 h of incubation&#44; 0 or 200 &#956;M H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> was added to the medium and maintained for 6 h to establish control HFF or H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced HFF&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Cell transfection</span><p id="par0030" class="elsevierStylePara elsevierViewall">MiR-181a inhibitor and miR-NC were purchased from GenePharma &#40;Shanghai&#44; China&#41; and were transfected into HFF &#40;50 nM&#41; for inhibiting miR-181a&#46; Short hairpin RNA specifically targeting PDIA6 &#40;sh-PDIA6&#41;&#44; and control sh-NC also purchased from GenePharma were transfected into HFF &#40;2 &#956;g&#47;&#956;L&#41; for downregulating PDIA6&#46; Cell transfection was achieved by lipofectamine 2000 &#40;Invitrogen&#41; following the manufacturer&#8217;s recommendations&#46; After 48 h&#44; the transfection efficiency was assessed by RT-qPCR&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Cell counting Kit-8 &#40;CCK-8&#41; assay</span><p id="par0035" class="elsevierStylePara elsevierViewall">After H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment and&#47;or indicated transfection&#44; 10 &#956;L of CCK-8 solution &#40;Dojindo&#44; Kumamoto&#44; Japan&#41; was added to the medium&#44; and HFF were cultured at 37 &#176;C for another 2 h&#46; Then&#44; a microplate reader &#40;Molecular Devices&#44; Shanghai&#44; China&#41; was utilized for measuring the absorbance at 450 nm according to the manufacturer&#8217;s instructions&#46; All experiments were performed thrice&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Reverse transcription-quantitative polymerase chain reaction &#40;RT-qPCR&#41;</span><p id="par0040" class="elsevierStylePara elsevierViewall">Total RNA was isolated from HFF using TRIzol reagent &#40;Invitrogen&#41;&#46; Synthesis of cDNA was achieved by reverse transcription of total RNA using PrimeScript&#8482; RT reagent Kit &#40;Takara&#44; Dalian&#44; China&#41;&#46; RT-qPCR was implemented using SYBR&#174; Premix Ex Taq&#8482; II &#40;Takara&#41; on a CFX96&#8482; Real-Time System &#40;Bio-Rad&#44; Hercules&#44; CA&#44; USA&#41;&#46; The relative expression levels of miR-181a and its downstream targets were calculated with the 2<span class="elsevierStyleSup">&#8722;&#916;&#916;Ct</span> method&#44; with U6 and GAPDH as normalization&#44; respectively&#46; All experiments were performed in triplicate&#46; Primer sequences are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Western blotting</span><p id="par0045" class="elsevierStylePara elsevierViewall">HFF were lysed in RIPA buffer &#40;Cell Signaling&#44; Danvers&#44; MA&#44; USA&#41; and the concentration of proteins was measured by a BCA kit &#40;Bio-Rad&#41;&#46; Protein samples &#40;20 &#956;g&#41; were separated by 10&#37; SDS-PAGE gels&#44; transferred to polyvinylidene fluoride &#40;PVDF&#41; membranes &#40;Millipore&#44; Billerica&#44; MA&#44; USA&#41;&#44; and blocked with 5&#37; non-fat milk&#46; Afterwards&#44; the membranes were incubated at 4 &#176;C overnight with primary antibodies as follows&#58; anti-p21 &#40;ab109520&#44; 1&#58;1000&#41;&#44; anti-p53 &#40;ab32389&#44; 1&#58;10000&#41;&#44; anti-SMP30 &#40;ab233007&#44; 1&#58;400&#41;&#44; anti-beta-actin &#40;ab115777&#44; 1&#58;200&#41;&#44; anti-PDIA6 &#40;ab154820&#44; 1&#58;1000&#41; &#40;all from Abcam&#44; Cambridge&#44; MA&#44; USA&#41; followed by incubation with secondary antibody &#40;ab97080&#44; Abcam&#41; for 1 h at room temperature&#46; Beta-actin was used as a loading control&#46; The proteins were visualized with an ECL system &#40;Bio-Rad&#41; and quantified by ImageJ software &#40;National Institutes of Health&#44; Bethesda&#44; MD&#44; USA&#41;&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">SA-&#946;-gal staining</span><p id="par0050" class="elsevierStylePara elsevierViewall">HFF were washed with PBS and fixed in 3&#37; formaldehyde at room temperature for 15 min&#46; After washing with PBS twice&#44; HFF were incubated overnight at 37 &#176;C with &#946;-galactosidase staining reagents &#40;1 mg&#47;mL X-gal&#44; 2 mM MgCl<span class="elsevierStyleInf">2</span>&#44; 150 mM NaCl&#44; pH 6&#46;0&#44; 5 mM potassium ferrocyanide&#44; 5 mM potassium ferricyanide and 40 nM citric acid&#47;sodium phosphate&#58; Beyotime&#44; Shanghai&#44; China&#41;&#46; Eventually&#44; stained HFF were imaged with a light microscope &#40;Nikon&#44; Tokyo&#44; Japan&#41; at 50&#215; magnification&#44; and the percentage of positive cells were analyzed with Image-Pro Plus 6&#46;0 &#40;Media Cybernetics&#44; Silver Spring&#44; MD&#44; USA&#41;&#46; All experiments were performed three times&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Detection of SOD&#44; GPx and CAT activities</span><p id="par0055" class="elsevierStylePara elsevierViewall">The activities of SOD&#44; GPx and CAT were measured as previously described&#46;<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> Briefly&#44; one unit of SOD was defined as the amount of enzyme that suppressed 50&#37; of the formazan&#47;min&#46; Xanthine and xanthine oxidase were utilized to produce superoxide anions&#46; The reaction between superoxide anions and tetrasodium chloride formed yellow formazan whose absorption was evaluated at 450 nm&#46; For GPx&#44; enzymatic reactions in tubes containing reduced glutathione&#44; glutathione reductase and NADPH&#44; were initiated by adding cumene hydroperoxide&#46; GPx activity was measured with a wavelength of 340 nm&#46; For CAT activity&#44; one unit of CAT was defined as the amount of enzyme that decomposed 1 M of H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#47;min&#46; The rate of decomposition of H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> was assessed at 570 nm&#46; The SOD&#44; GPx and CAT assay kits &#40;Jiancheng Bioengineering Institute&#44; Nanjing&#44; China&#41; were used for spectrophotometrically detecting the enzyme activities which were expressed as U&#47;mg of protein&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Luciferase reporter assay</span><p id="par0060" class="elsevierStylePara elsevierViewall">The complementary binding site of miR-181a on PDIA6 3&#8217;UTR was predicted by TargetScan &#40;<a href="http://www.targetscan.org/vert_71/">http&#58;&#47;&#47;www&#46;targetscan&#46;org&#47;vert&#95;71&#47;</a>&#41;&#46; The wild-type or mutant sequences of PDIA6 3&#8217;UTR were subcloned into pmirGLO vectors &#40;Promega&#44; Madison&#44; WI&#44; USA&#41; to establishPDIA6-Wt&#47;Mut&#46; Afterward&#44; these vectors were co-transfected into HFF with miR-181a inhibitor or miR-NC using Lipofectamine 2000 &#40;Invitrogen&#41;&#46; After 48 h of transfection&#44; the luciferase activity was evaluated by a dual-luciferase reporter kit &#40;Promega&#41;&#44; normalized to Renilla luciferase activity&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Statistical analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">SPSS 18&#46;0 &#40;SPSS&#44; Chicago&#44; IL&#44; USA&#41; was utilized for statistical analysis&#46; Data are presented as the mean &#177; standard deviation&#46; Differences between two groups were analyzed by Student&#8217;s <span class="elsevierStyleItalic">t</span>-test while those among more than two groups were assessed by analysis of variance &#40;ANOVA&#41; followed by Tukey&#8217;s <span class="elsevierStyleItalic">post-hoc</span> analysis&#46; Each experiment was repeated at least three times&#46; The value of p &#60; 0&#46;05 was considered significant&#46;</p></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Results</span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Downregulation of miR-181a mitigates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence and oxidative stress</span><p id="par0070" class="elsevierStylePara elsevierViewall">First&#44; the authors detected miR-181a levels in HFF by RT-qPCR&#46; Relative to the control group&#44; miR-181a level was increased in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF and was reduced after transfection of miR-181a inhibitor &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A&#41;&#46; Next&#44; the impact of miR-181a on the viability of HFF was assessed&#46; As revealed by CCK-8 assay&#44; H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment markedly reduced the viability of HFF&#44; while miR-181a depletion attenuated this effect &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>B&#41;&#44; suggesting that downregulated miR-181a might protect HFF against H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cell damage&#46; Moreover&#44; detection of SA-&#946;-gal activity displayed that miR-181a inhibition led to a reduction in the H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced increased percentage of SA-&#946;-gal positive cells &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>C&#41;&#46; A similar trend was observed in the results of western blotting&#46; Protein levels of senescence markers &#40;p21&#44; p53 and SMP30&#41; were significantly raised by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment in HFF compared to the control groups and were then decreased by miR-181a inhibitor &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>D&#8210;G&#41;&#46; The above results indicated that downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence in HFF&#46; Subsequently&#44; the authors tested whether miR-181a had an impact on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress&#46; As shown by Figure 1 H&#8210;J&#44; H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment markedly elevated the activity of SOD&#44; GPx&#44; and CAT&#44; which was partially reversed after the downregulation of miR-181a in HFF&#46; The results suggested that the antioxidant enzymes actively respond to oxidative stress and miR-181a inhibition can relieve H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">MiR-181a targets PDIA6</span><p id="par0075" class="elsevierStylePara elsevierViewall">As shown in Figure 2A&#44; four downstream targets of miR-181a were screened out by ENCORI &#40;<a href="https://starbase.sysu.edu.cn/">https&#58;&#47;&#47;starbase&#46;sysu&#46;edu&#46;cn&#47;</a>&#41; with the condition of a number of supported AGO CLIP-seq experiments &#40;AgoExpNum&#41; &#8805;40&#46; Results from RT-qPCR showed that after inhibiting miR-181a in HFF&#44; only the PDIA6 level was significantly enhanced &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>B&#41;&#46; Likewise&#44; western blotting displayed that miR-181a inhibitor increased the protein level of PDIA6 in HFF &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>C&#41;&#46; The existence of putative complementary site between miR-181a and PDIA6 was predicted by TargetScan &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>D&#41;&#46; Moreover&#44; the luciferase activity of PDIA6-Wt was upregulated in HFF after transfection of miR-181a inhibitor&#44; while that of PDIA6-Mut was not significantly influenced&#44; as shown by luciferase reporter assay &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>E&#41;&#46; Notably&#44; RT-qPCR and western blotting demonstrated that mRNA and protein expression of PDIA6 was markedly downregulated in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF compared with the control group &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>F&#8210;H&#41;&#46; Collectively&#44; PDIA6 is a target for miR-181a in HFF&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">PDIA6 knockdown reverses miR-181a inhibition-mediated suppressive impact on cellular senescence and oxidative stress</span><p id="par0080" class="elsevierStylePara elsevierViewall">To investigate the impact of PDIA6 on cellular senescence in HFF&#44; the authors first transfected sh-PDIA6 into HFF&#46; The mRNA and protein expression levels of PDIA6 were decreased in HFF transfected with sh-PDIA6&#44; as displayed by RT-qPCR and western blotting&#44; respectively &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A&#8210;C&#41;&#46; CCK-8 assay revealed that miR-181a inhibitor promoted the viability of HFF while co-transfection of sh-PDIA6 attenuated this effect &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>D&#41;&#46; Additionally&#44; results from SA-&#946;-gal staining displayed that depletion of miR-181a significantly reduced the percentage of SA-&#946;-gal positive cells&#44; which was partially reversed by knocking down miR-181a and PDIA6 simultaneously &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>E&#8210;F&#41;&#46; This was consistent with western blotting which showed that knocking down PDIA6 rescued the reduction in senescence marker protein levels caused by miR-181a inhibitor in HFF &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>G&#8210;J&#41;&#46; Hence&#44; it was suggested by the above results that downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-mediated cellular senescence by targeting PDIA6&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">Then&#44; the authors tested whether miR-181a exerted its influence on oxidative stress by regulating PDIA6&#46; As exhibited by the results&#44; knocking down PDIA6 alleviated the suppressive effect on SOD&#44; GPx and CAT activities in HFF resulting from miR-181a inhibitor &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>K&#8210;M&#41;&#46; This revealed that downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress by targeting PDIA6&#46;</p></span></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Discussion</span><p id="par0090" class="elsevierStylePara elsevierViewall">The damage resulting from decreased antioxidant ability and imbalance of the oxidative system is termed oxidative stress&#46;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> Emerging evidence has suggested that oxidative stress in the skin is a key cause of cellular senescence&#44; consequently leading to skin aging&#46;<a class="elsevierStyleCrossRefs" href="#bib0115"><span class="elsevierStyleSup">23&#44;24</span></a> Previous studies have elucidated that aging and ultraviolet B &#40;UVB&#41; exposure are strongly correlated with the high risk of skin cancer&#46;<a class="elsevierStyleCrossRefs" href="#bib0125"><span class="elsevierStyleSup">25&#44;26</span></a> It is suggested that an increased presence of senescent fibroblasts in geriatric skin causes the silencing of insulin-like growth factor 1 &#40;IGF-1&#41; expression in the skin&#46;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> The silencing of IGF-1 in senescent fibroblasts results in an inappropriate UVB-response and the proliferation of keratinocytes containing DNA damage&#44; which ultimately leads to photocarcinogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> Hence&#44; finding an effective approach to alleviate cellular senescence might help to reduce skin carcinogenic risk&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">Numerous studies have demonstrated the significant effects of miRNAs involved in oxidative stress and cellular senescence&#44; such as miR-1445-5p&#44; miR-570&#44; and miR-93-5p&#46;<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">28&#8211;30</span></a> Previous studies have verified that miR-181a plays a crucial role in cellular senescence&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a> MiR-181a was reported to exhibit elevated expression in keratinocytes during replicative senescence&#44; suggesting that overexpressed miR-181a might play a promotive role in cellular senescence&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a> In this study&#44; the authors examined the role of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#46; Senescent cells are characterized by cell growth arrest and abnormal gene expression&#46;<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">33</span></a> Thus&#44; the role of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF was identified by detecting its influences on cell viability&#44; SA-&#946;-gal staining&#44; and expression levels of senescence markers&#46; It was revealed that downregulated miR-181a could enhance cell viability and suppress cellular senescence caused by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> in HFF&#46; Furthermore&#44; to detect the impact of miR-181a on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress&#44; the authors assessed the activities of the antioxidants &#40;SOD&#44; GPx and CAT&#41; which are key regulators in the oxidative system&#46; It was found that miR-181a inhibition significantly decreased the antioxidant abilities in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#44; indicating that knocking down miR-181a is able to suppress oxidative stress induced by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">MiRNAs are recognized to modulate the expression of downstream targets by base-pairing to the sequences of mRNA 3&#8217;UTRs&#46;<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">34</span></a> To figure out how miR-181a exerts its influences on oxidative stress and cellular senescence&#44; the bioinformatics tool ENCORI was utilized for screening the downstream targets of miR-181a&#46; Among the selected mRNAs&#44; the authors finally identified PDIA6 as the target gene of miR-181a&#46; PDIA6&#44; a member of the disulfide isomerase family&#44; is implicated in various human diseases&#44; such as diabetes mellitus&#44; liver fibrosis&#44; and various cancers&#46;<a class="elsevierStyleCrossRefs" href="#bib0175"><span class="elsevierStyleSup">35&#44;36</span></a> Additionally&#44; a previous study suggested that PDIA6 is closely related to cellular senescence in human BMSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> In the present study&#44; PDIA6 exhibited decreased expression in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF in comparison to the control group&#46; Intriguingly&#44; miR-181a inhibition alleviated H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>- induced oxidative stress in HFF and cellular senescence&#44; and knocking down PDIA6 reversed the inhibitory impact on cellular senescence and oxidative stress mediated by downregulated miR-181a&#46; This suggested that silencing miR-181a mitigated H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence and oxidative stress by targeting PDIA6&#44; and PDIA6 might protect HFF from cellular senescence induced by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Conclusion</span><p id="par0105" class="elsevierStylePara elsevierViewall">In conclusion&#44; the potential role and mechanism of miR-181a in regulating H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF were investigated&#46; The results revealed that downregulated miR-181a can ameliorate H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF by regulating PDIA6&#46; The present findings might help to develop a new perspective for improving skin aging and senescence-associated disorders&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Financial support</span><p id="par0110" class="elsevierStylePara elsevierViewall">The study was supported by the M<span class="elsevierStyleGrantSponsor" id="gs0005">edical Science Research Project of the Wuhan Municipal Health Commission</span> &#40;grant n&#186; <span class="elsevierStyleGrantNumber" refid="gs0005">WX20Q03&#41;</span>&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Author&#39;s contribution</span><p id="par0115" class="elsevierStylePara elsevierViewall">Yan Huang&#58; Critical literature review&#59; data collection&#59; effective participation in research orientation&#59; intellectual participation in propaedeutic and&#47;or therapeutic management of studied cases&#59; manuscript critical review&#59; preparation and writing of the manuscript&#59; statistical analysis&#59; study conception and planning&#59; approval of the final version of the manuscript&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">Huimin Yan&#58; Critical literature review&#59; data collection&#59; analysis and interpretation&#59; effective participation in research orientation&#59; intellectual participation in propaedeutic and&#47;or therapeutic management of studied cases&#59; manuscript critical review&#59; preparation and writing of the manuscript&#59; statistical analysis&#59; study conception and planning&#59; approval of the final version of the manuscript&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">Yanqing Yang&#58; Data collection&#59; analysis and interpretation&#59; approval of the final version of the manuscript&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">Jinfei Zhou&#58; Data collection&#59; analysis and interpretation&#59; approval of the final version of the manuscript&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Qijun Xu&#58; Effective participation in research orientation&#59; statistical analysis&#59; approval of the final version of the manuscript&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Meng Hu&#58; Critical literature review&#59; data collection&#59; analysis and interpretation&#59; effective participation in research orientation&#59; intellectual participation in propaedeutic and&#47;or therapeutic management of studied cases&#59; manuscript critical review&#59; preparation and writing of the manuscript&#59; statistical analysis&#59; approval of the final version of the manuscript&#46;</p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Conflicts of interest</span><p id="par0145" class="elsevierStylePara elsevierViewall">None declared&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:11 [
        0 => array:3 [
          "identificador" => "xres1881234"
          "titulo" => "Abstract"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Objective"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Study limitations"
            ]
            5 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1630586"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:9 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Cell culture"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Cell transfection"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Cell counting Kit-8 &#40;CCK-8&#41; assay"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Reverse transcription-quantitative polymerase chain reaction &#40;RT-qPCR&#41;"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Western blotting"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "SA-&#946;-gal staining"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Detection of SOD&#44; GPx and CAT activities"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Luciferase reporter assay"
            ]
            8 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:3 [
          "identificador" => "sec0060"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Downregulation of miR-181a mitigates HO-induced cellular senescence and oxidative stress"
            ]
            1 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "MiR-181a targets PDIA6"
            ]
            2 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "PDIA6 knockdown reverses miR-181a inhibition-mediated suppressive impact on cellular senescence and oxidative stress"
            ]
          ]
        ]
        5 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Conclusion"
        ]
        7 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Financial support"
        ]
        8 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Author&#39;s contribution"
        ]
        9 => array:2 [
          "identificador" => "sec0100"
          "titulo" => "Conflicts of interest"
        ]
        10 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2021-10-26"
    "fechaAceptado" => "2021-12-03"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1630586"
          "palabras" => array:3 [
            0 => "Cellular senescence"
            1 => "Oxidative stress"
            2 => "Protein disulfide-isomerases"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Oxidative stress is strongly associated with cellular senescence&#46; Numerous studies have indicated that microRNAs &#40;miRNAs&#41; play a critical part in cellular senescence&#46; MiR-181a was reported to induce cellular senescence&#44; however&#44; the potential mechanism of miR-181a in hydrogen peroxide &#40;H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#41;-induced cellular senescence remains obscure&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Objective</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">The aim of this study is to investigate the role and regulatory mechanism of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Human foreskin fibroblasts &#40;HFF&#41; transfected with miR-181a inhibitor&#47;miR-NC with or without H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment were divided into four groups&#58; control &#43; miR-NC&#47;miR-181a inhibitor&#44; H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> &#43; miR-NC&#47;miR-181a inhibitor&#46; CCK-8 assay was utilized to evaluate the viability of HFF&#46; RT-qPCR was used to measure the expression of miR-181a and its target genes&#46; Protein levels of protein disulfide isomerase family A member 6 &#40;PDIA6&#41; and senescence markers were assessed by western blotting&#46; Senescence-associated &#946;-galactosidase &#40;SA-&#946;-gal&#41; staining was applied for detecting SA-&#946;-gal activity&#46; The activities of SOD&#44; GPx&#44; and CAT were detected by corresponding assay kits&#46; The binding relation between PDIA6 and miR-181a was identified by luciferase reporter assay&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">MiR-181a inhibition suppressed H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF&#46; PDIA6 was targeted by miR-181a and lowly expressed in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#46; Knocking down PDIA6 reversed miR-181a inhibition-mediated suppressive impact on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Study limitations</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Signaling pathways that might be mediated by miR-181a&#47;PDIA6 axis were not investigated&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Conclusion</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Downregulated miR-181a attenuates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF by targeting PDIA6&#46;</p></span>"
        "secciones" => array:6 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Objective"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Study limitations"
          ]
          5 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "NotaPie" => array:2 [
      0 => array:2 [
        "etiqueta" => "&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Study conducted at the Wuhan Third Hospital&#44; Wuhan&#44; China&#46;</p>"
      ]
      1 => array:3 [
        "etiqueta" => "1"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0015">These authors contributed equally to the work&#46;</p>"
        "identificador" => "fn0005"
      ]
    ]
    "multimedia" => array:4 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 3658
            "Ancho" => 3341
            "Tamanyo" => 813397
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0100"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">MiR-181a depletion mitigates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence and oxidative stress&#46;</span> Assays were conducted in HFF with different treatments &#40;with or without H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#59; transfection of miR-NC or miR-181a inhibitor&#41;&#46; &#40;A&#41; RT-qPCR analysis of miR-181a level&#46; &#40;B&#41; CCK-8 assay for evaluating cell viability&#46; &#40;C&#41; SA-&#946;-gal staining for assessing SA-&#946;-gal activity&#46; Cell pictures were imaged at 50&#215; magnification&#46; &#40;D&#8210;G&#41; Western blotting for measuring protein levels of senescence markers&#46; &#40;H&#8210;J&#41; Measurement of the activities of SOD&#44; GPx and CAT in HFF&#46; &#42;p &#60; 0&#46;05&#44; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 3121
            "Ancho" => 3341
            "Tamanyo" => 528405
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0105"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">MiR-181a binds with PDIA6&#46;</span> &#40;A&#41; Four downstream targets of miR-181a predicted by ENCORI&#46; &#40;B&#41; RT-qPCR analysis for assessing these mRNA levels in HFF transfected with miR-181a inhibitor&#46; &#40;C&#41; Western blotting of PDIA6 protein expression in miR-181a inhibitor-transfected HFF&#46; &#40;D&#41; The binding site of miR-181a on PDIA6 3&#8217;UTR predicted by TargetScan&#46; &#40;E&#41; Luciferase reporter assay for elucidating the binding relation between PDIA6 and miR-181a&#46; &#40;F&#41; RT-qPCR analysis of PDIA6 level in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#46; G&#8211;H&#46; Western blotting of PDIA6 protein level in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF and control group&#46; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 4175
            "Ancho" => 2773
            "Tamanyo" => 678384
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0110"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">PDIA6 knockdown reverses miR-181a inhibitor-mediated suppressive impact on cellular senescence and oxidative stress&#46;</span> &#40;A&#41; RT-qPCR analysis of PDIA6 expression in sh-PDIA6-transfected HFF&#46; &#40;B&#8210;C&#41; Western blotting of PDIA6 protein expression in transfected HFF&#46; &#40;D&#41; CCK-8 assay for evaluating the viability of HFF with transfection of miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#40;E&#8210;F&#41; SA-&#946;-gal staining for assessing the percentage of SA-&#946;-gal positive cells of HFF with above transfection&#46; Cell pictures were imaged at 50&#215; magnification&#46; &#40;G&#8210;J&#41; Western blotting for detecting concentration of senescence markers in HFF with above transfection&#46; &#40;K&#8210;M&#41; Measurement of the activities of SOD&#44; GPx and CAT in HFF transfected with miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#42;p &#60; 0&#46;05&#44; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0115"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence &#40;5&#8217;&#8594; 3&#8217;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">hsa-miR-181a-5p forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACACTCCAGCTGGGAACATTCAACGCTGTCGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">hsa-miR-181a-5p reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGGTGTCGTGGAGTCGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">PDIA6 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCCTGCCCACTCCCTATCAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">PDIA6 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAACTGTATCCTCCGCTCCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TNPO1 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GACGCGCCTACGGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TNPO1 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGTTGCACGGTTCTCTGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HMGB2 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCCAACAGGCTCAAAGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HMGB2 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CACACATTCCACACGCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CBX4 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGGAGTATCTGGTGAAATGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CBX4 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACGACGGGCAAAGGTAGGCAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGCACCACCAACTGCTTAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGCATGGACTGTGGTCATGAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U6 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTCGCTTGGGCAGCACA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U6 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AACGCTTCACGAATTTGCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Primer sequences used for RT-qPCR&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:36 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cellular senescence in development&#44; regeneration&#44; and disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Rhinn"
                            1 => "B&#46; Ritschka"
                            2 => "W&#46;M&#46; Keyes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Development&#46;"
                        "fecha" => "2019"
                        "paginaInicial" => "146"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The impact of cellular senescence in skin ageing&#58; a notion of mosaic and therapeutic strategies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Toutfaire"
                            1 => "E&#46; Bauwens"
                            2 => "F&#46; Debacq-Chainiaux"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bcp.2017.04.011"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Pharmacol&#46;"
                        "fecha" => "2017"
                        "volumen" => "142"
                        "paginaInicial" => "1"
                        "paginaFinal" => "12"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28408343"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cellular senescence&#58; what&#44; why&#44; and how"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46;J&#46; Regulski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Wounds&#46;"
                        "fecha" => "2017"
                        "volumen" => "29"
                        "paginaInicial" => "168"
                        "paginaFinal" => "174"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28682291"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Techniques to induce and quantify cellular senescence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "N&#46; Noren Hooten"
                            1 => "M&#46;K&#46; Evans"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "J Vis Exp&#46;"
                        "fecha" => "2017"
                        "volumen" => "1"
                        "paginaInicial" => "55533"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "What is and what is not cell senescence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "E&#46; Sikora"
                            1 => "A&#46; Bielak-&#379;mijewska"
                            2 => "G&#46; Mosieniak"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18388/pb.2018_120"
                      "Revista" => array:6 [
                        "tituloSerie" => "Postepy Biochem&#46;"
                        "fecha" => "2018"
                        "volumen" => "64"
                        "paginaInicial" => "110"
                        "paginaFinal" => "118"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30656893"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "How good is the evidence that cellular senescence causes skin ageing&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Low"
                            1 => "G&#46; Alimohammadiha"
                            2 => "L&#46;A&#46; Smith"
                            3 => "L&#46;F&#46; Costello"
                            4 => "S&#46;A&#46; Przyborski"
                            5 => "T&#46; von Zglinicki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Ageing Res Rev&#46;"
                        "fecha" => "2021"
                        "volumen" => "71"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oxidative stress down-regulates MiR-20b-5p&#44; MiR-106a-5p and E2F1 expression to suppress the G1&#47;S transition of the cell cycle in multipotent stromal cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "L&#46; Tai"
                            1 => "C&#46;J&#46; Huang"
                            2 => "K&#46;B&#46; Choo"
                            3 => "S&#46;K&#46; Cheong"
                            4 => "T&#46; Kamarul"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.7150/ijms.38832"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Med Sci&#46;"
                        "fecha" => "2020"
                        "volumen" => "17"
                        "paginaInicial" => "457"
                        "paginaFinal" => "470"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32174776"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Exogenous antioxidants-double-edged swords in cellular redox state&#58; health beneficial effects at physiologic doses versus deleterious effects at high doses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Bouayed"
                            1 => "T&#46; Bohn"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4161/oxim.3.4.12858"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oxid Med Cell Longev&#46;"
                        "fecha" => "2010"
                        "volumen" => "3"
                        "paginaInicial" => "228"
                        "paginaFinal" => "237"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20972369"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Levels of selenium&#44; zinc&#44; copper&#44; and antioxidant enzyme activity in patients with leukemia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "X&#46;L&#46; Zuo"
                            1 => "J&#46;M&#46; Chen"
                            2 => "X&#46; Zhou"
                            3 => "X&#46;Z&#46; Li"
                            4 => "G&#46;Y&#46; Mei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Biol Trace Elem Res&#46;"
                        "fecha" => "2006"
                        "volumen" => "114"
                        "paginaInicial" => "41"
                        "paginaFinal" => "53"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Altered antioxidant capacity in human renal cell carcinoma&#58; role of glutathione associated enzymes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Pljesa-Ercegovac"
                            1 => "J&#46; Mimic-Oka"
                            2 => "D&#46; Dragicevic"
                            3 => "A&#46; Savic-Radojevic"
                            4 => "M&#46; Opacic"
                            5 => "S&#46; Pljesa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.urolonc.2007.02.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "Urol Oncol&#46;"
                        "fecha" => "2008"
                        "volumen" => "26"
                        "paginaInicial" => "175"
                        "paginaFinal" => "181"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18312938"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clustered miRNAs and their role in biological functions and diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46;P&#46; Kabekkodu"
                            1 => "V&#46; Shukla"
                            2 => "V&#46;K&#46; Varghese"
                            3 => "J&#46; D&#8217; Souza"
                            4 => "S&#46; Chakrabarty"
                            5 => "K&#46; Satyamoorthy"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/brv.12428"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biol Rev Camb Philos Soc&#46;"
                        "fecha" => "2018"
                        "volumen" => "93"
                        "paginaInicial" => "1955"
                        "paginaFinal" => "1986"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29797774"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of online miRNA resources for biomedical applications"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "N&#46;H&#46; Tan Gana"
                            1 => "A&#46;F&#46; Victoriano"
                            2 => "T&#46; Okamoto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2443.2011.01564.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genes Cells&#46;"
                        "fecha" => "2012"
                        "volumen" => "17"
                        "paginaInicial" => "11"
                        "paginaFinal" => "27"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22077698"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-based therapeutics in cardiovascular disease&#58; screening and delivery to the target"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46; Mellis"
                            1 => "A&#46; Caporali"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BST20170037"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Soc Trans&#46;"
                        "fecha" => "2018"
                        "volumen" => "46"
                        "paginaInicial" => "11"
                        "paginaFinal" => "21"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29196609"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Microrna-217 modulates human skin fibroblast senescence by directly targeting DNA methyltransferase 1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Wang"
                            1 => "R&#46; Du"
                            2 => "X&#46; Xiao"
                            3 => "Z&#46;L&#46; Deng"
                            4 => "D&#46; Jian"
                            5 => "H&#46;F&#46; Xie"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/oncotarget.16509"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncotarget&#46;"
                        "fecha" => "2017"
                        "volumen" => "8"
                        "paginaInicial" => "33475"
                        "paginaFinal" => "33486"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28380423"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-23a-3p causes cellular senescence by targeting hyaluronan synthase 2&#58; possible implication for skin aging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; R&#246;ck"
                            1 => "J&#46; Tigges"
                            2 => "S&#46; Sass"
                            3 => "A&#46; Sch&#252;tze"
                            4 => "A&#46;M&#46; Florea"
                            5 => "A&#46;C&#46; Fender"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/jid.2014.422"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Invest Dermatol&#46;"
                        "fecha" => "2015"
                        "volumen" => "135"
                        "paginaInicial" => "369"
                        "paginaFinal" => "377"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25264594"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-152 and -181a participate in human dermal fibroblasts senescence acting on cell adhesion and remodeling of the extra-cellular matrix"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Mancini"
                            1 => "G&#46; Saintigny"
                            2 => "C&#46; Mah&#233;"
                            3 => "M&#46; Annicchiarico-Petruzzelli"
                            4 => "G&#46; Melino"
                            5 => "E&#46; Candi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/aging.100508"
                      "Revista" => array:6 [
                        "tituloSerie" => "Aging &#40;Albany NY&#41;&#46;"
                        "fecha" => "2012"
                        "volumen" => "4"
                        "paginaInicial" => "843"
                        "paginaFinal" => "853"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23238588"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Downregulation of miR-181a-5p alleviates oxidative stress and inflammation in coronary microembolization-induced myocardial damage by directly targeting XIAP"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46; Zhou"
                            1 => "M&#46;Y&#46; Long"
                            2 => "Z&#46;Q&#46; Chen"
                            3 => "J&#46;W&#46; Huang"
                            4 => "Z&#46;B&#46; Qin"
                            5 => "L&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.11909/j.issn.1671-5411.2021.06.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Geriatr Cardiol&#46;"
                        "fecha" => "2021"
                        "volumen" => "18"
                        "paginaInicial" => "426"
                        "paginaFinal" => "439"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34220972"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A point mutation in the Pdia6 gene results in loss of pancreatic &#946;-cell identity causing overt diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46;F&#46; Chhabra"
                            1 => "A&#46;L&#46; Amend"
                            2 => "A&#46; Bastidas-Ponce"
                            3 => "S&#46; Sabrautzki"
                            4 => "M&#46; Tarquis-Medina"
                            5 => "S&#46; Sachs"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Mol Metab&#46;"
                        "fecha" => "2021"
                        "volumen" => "54"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Expression profiles of subtracted mRNAs during cellular senescence in human mesenchymal stem cells derived from bone marrow"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;K&#46; Yoo"
                            1 => "S&#46;J&#46; Choi"
                            2 => "J&#46;K&#46; Kim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.exger.2013.02.022"
                      "Revista" => array:6 [
                        "tituloSerie" => "Exp Gerontol&#46;"
                        "fecha" => "2013"
                        "volumen" => "48"
                        "paginaInicial" => "464"
                        "paginaFinal" => "471"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23466301"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mitochondrial P5&#44; a member of protein disulphide isomerase family&#44; suppresses oxidative stress-induced cell death"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Shitara"
                            1 => "Y&#46; Tonohora"
                            2 => "T&#46; Goto"
                            3 => "Y&#46; Yamada"
                            4 => "T&#46; Miki"
                            5 => "H&#46; Makino"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/jb/mvs034"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biochem&#46;"
                        "fecha" => "2012"
                        "volumen" => "152"
                        "paginaInicial" => "73"
                        "paginaFinal" => "85"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22492663"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevention of oxidative stress in Chang liver cells by gallic acid-grafted-chitosans"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Senevirathne"
                            1 => "Y&#46;J&#46; Jeon"
                            2 => "Y&#46;T&#46; Kim"
                            3 => "P&#46;J&#46; Park"
                            4 => "W&#46;K&#46; Jung"
                            5 => "C&#46;B&#46; Ahn"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.carbpol.2011.08.080"
                      "Revista" => array:6 [
                        "tituloSerie" => "Carbohydr Polym&#46;"
                        "fecha" => "2012"
                        "volumen" => "87"
                        "paginaInicial" => "876"
                        "paginaFinal" => "880"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34663049"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oxidative stress&#58; oxidants and antioxidants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "H&#46; Sies"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1113/expphysiol.1997.sp004024"
                      "Revista" => array:6 [
                        "tituloSerie" => "Exp Physiol&#46;"
                        "fecha" => "1997"
                        "volumen" => "82"
                        "paginaInicial" => "291"
                        "paginaFinal" => "295"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9129943"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "6&#44;4&#8217;-dihydroxy-7-methoxyflavanone protects against H&#40;2&#41;O&#40;2&#41;-induced cellular senescence by inducing SIRT1 and inhibiting phosphatidylinositol 3-kinase&#47;Akt pathway activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "B&#46;S&#46; Li"
                            1 => "R&#46;Z&#46; Zhu"
                            2 => "B&#46;M&#46; Choi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11010-020-03951-z"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Cell Biochem&#46;"
                        "fecha" => "2021"
                        "volumen" => "476"
                        "paginaInicial" => "863"
                        "paginaFinal" => "872"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33111210"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biomarkers&#44; oxidative stress and autophagy in skin aging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Gu"
                            1 => "J&#46; Han"
                            2 => "C&#46; Jiang"
                            3 => "Y&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Ageing Res Rev&#46;"
                        "fecha" => "2020"
                        "volumen" => "59"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Impact of age and insulin-like growth factor-1 on DNA damage responses in UV-irradiated human skin"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;G&#46; Kemp"
                            1 => "D&#46;F&#46; Spandau"
                            2 => "J&#46;B&#46; Travers"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/molecules22030356"
                      "Revista" => array:5 [
                        "tituloSerie" => "Molecules&#46;"
                        "fecha" => "2017"
                        "volumen" => "22"
                        "paginaInicial" => "356"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28245638"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Randomized controlled trial of fractionated laser resurfacing on aged skin as prophylaxis against actinic neoplasia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;F&#46; Spandau"
                            1 => "R&#46; Chen"
                            2 => "J&#46;J&#46; Wargo"
                            3 => "C&#46;A&#46; Rohan"
                            4 => "D&#46; Southern"
                            5 => "A&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "J Clin Invest&#46;"
                        "fecha" => "2021"
                        "volumen" => "131"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The IGF-1&#47;IGF-1R signaling axis in the skin&#58; a new role for the dermis in aging-associated skin cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "D&#46;A&#46; Lewis"
                            1 => "J&#46;B&#46; Travers"
                            2 => "A&#46;K&#46; Somani"
                            3 => "D&#46;F&#46; Spandau"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/onc.2009.440"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene&#46;"
                        "fecha" => "2010"
                        "volumen" => "29"
                        "paginaInicial" => "1475"
                        "paginaFinal" => "1485"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19966862"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dioscin ameliorates methotrexate-induced liver and kidney damages via adjusting miRNA-145-5p-mediated oxidative stress"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Li"
                            1 => "M&#46; Gao"
                            2 => "L&#46;H&#46; Yin"
                            3 => "L&#46;N&#46; Xu"
                            4 => "Y&#46; Qi"
                            5 => "P&#46; Sun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.freeradbiomed.2021.03.035"
                      "Revista" => array:6 [
                        "tituloSerie" => "Free Radic Biol Med&#46;"
                        "fecha" => "2021"
                        "volumen" => "169"
                        "paginaInicial" => "99"
                        "paginaFinal" => "109"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33836263"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-570 is a novel regulator of cellular senescence and inflammaging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;R&#46; Baker"
                            1 => "C&#46; Vuppusetty"
                            2 => "T&#46; Colley"
                            3 => "S&#46; Hassibi"
                            4 => "P&#46;S&#46; Fenwick"
                            5 => "L&#46;E&#46; Donnelly"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.201800965R"
                      "Revista" => array:6 [
                        "tituloSerie" => "Faseb j&#46;"
                        "fecha" => "2019"
                        "volumen" => "33"
                        "paginaInicial" => "1605"
                        "paginaFinal" => "1616"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30156909"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-93-5p suppresses cellular senescence by directly targeting Bcl-w and p21"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;Y&#46; Choi"
                            1 => "H&#46;J&#46; Shin"
                            2 => "I&#46;H&#46; Bae"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbrc.2018.10.010"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Biophys Res Commun&#46;"
                        "fecha" => "2018"
                        "volumen" => "505"
                        "paginaInicial" => "1134"
                        "paginaFinal" => "1140"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30318121"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of microRNAs in endothelial cell pathophysiology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Staszel"
                            1 => "B&#46; Zapa&#322;a"
                            2 => "A&#46; Polus"
                            3 => "A&#46; Sadakierska-Chudy"
                            4 => "B&#46; Kie&#263;-Wilk"
                            5 => "E&#46; St&#281;pie&#324;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Pol Arch Med Wewn&#46;"
                        "fecha" => "2011"
                        "volumen" => "121"
                        "paginaInicial" => "361"
                        "paginaFinal" => "366"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21946298"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of microRNAs in organismal and skin aging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Gerasymchuk"
                            1 => "V&#46; Cherkasova"
                            2 => "O&#46; Kovalchuk"
                            3 => "I&#46; Kovalchuk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/ijms21155281"
                      "Revista" => array:5 [
                        "tituloSerie" => "Int J Mol Sci&#46;"
                        "fecha" => "2020"
                        "volumen" => "21"
                        "paginaInicial" => "5281"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32722415"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cellular senescence&#58; molecular mechanisms&#44; in vivo significance&#44; and redox considerations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46; Muller"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/ars.2008.2104"
                      "Revista" => array:6 [
                        "tituloSerie" => "Antioxid Redox Signal&#46;"
                        "fecha" => "2009"
                        "volumen" => "11"
                        "paginaInicial" => "59"
                        "paginaFinal" => "98"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18976161"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Von Hippel-Lindau gene single nucleotide polymorphism &#40;rs1642742&#41; may be related to the occurrence and metastasis of HBV-related hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "X&#46; Chen"
                            1 => "H&#46; Zhang"
                            2 => "S&#46; Ou"
                            3 => "H&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Medicine &#40;Baltimore&#41;&#46;"
                        "fecha" => "2021"
                        "volumen" => "100"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Key genes associated with diabetes mellitus and hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G&#46;M&#46; Liu"
                            1 => "H&#46;D&#46; Zeng"
                            2 => "C&#46;Y&#46; Zhang"
                            3 => "J&#46;W&#46; Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Pathol Res Pract&#46;"
                        "fecha" => "2019"
                        "volumen" => "215"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification and localization of xylose-binding proteins as potential biomarkers for liver fibrosis&#47;cirrhosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Zhong"
                            1 => "X&#46;X&#46; Sun"
                            2 => "P&#46; Zhang"
                            3 => "X&#46; Qin"
                            4 => "W&#46; Chen"
                            5 => "Y&#46; Guo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1039/c5mb00703h"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Biosyst&#46;"
                        "fecha" => "2016"
                        "volumen" => "12"
                        "paginaInicial" => "598"
                        "paginaFinal" => "605"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26687723"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03650596/0000009800000001/v2_202304080751/S0365059622002227/v2_202304080751/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "89516"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Article"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03650596/0000009800000001/v2_202304080751/S0365059622002227/v2_202304080751/en/main.pdf?idApp=UINPBA00008Z&text.app=https://clinics.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002227?idApp=UINPBA00008Z"
]
Share
Journal Information

Statistics

Follow this link to access the full text of the article

Original Article
Downregulated miR-181a alleviates H2O2-induced oxidative stress and cellular senescence by targeting PDIA6 in human foreskin fibroblasts
Yan Huanga,1, Huimin Yana,1, Yanqing Yanga, Jinfei Zhoub, Qijun Xua, Hu Menga,
Corresponding author
humeng7622@163.com

Corresponding author.
a Wuhan Third Hospital, Department of Plastic Surgery, Hubei, China
b Xiangyang Yilaimei Medical Beauty Clinic, Department of Aesthetic Dermatology, Hubei, China
Read
8121
Times
was read the article
1962
Total PDF
6159
Total HTML
Share statistics
 array:23 [
  "pii" => "S0365059622002227"
  "issn" => "03650596"
  "doi" => "10.1016/j.abd.2021.12.007"
  "estado" => "S300"
  "fechaPublicacion" => "2023-01-01"
  "aid" => "634"
  "copyright" => "Sociedade Brasileira de Dermatologia"
  "copyrightAnyo" => "2022"
  "documento" => "article"
  "crossmark" => 1
  "subdocumento" => "fla"
  "abierto" => array:3 [
    "ES" => false
    "ES2" => false
    "LATM" => false
  ]
  "gratuito" => false
  "lecturas" => array:1 [
    "total" => 0
  ]
  "Traduccion" => array:1 [
    "pt" => array:19 [
      "pii" => "S2666275222002375"
      "issn" => "26662752"
      "doi" => "10.1016/j.abdp.2022.10.003"
      "estado" => "S300"
      "fechaPublicacion" => "2023-01-01"
      "aid" => "634"
      "copyright" => "Sociedade Brasileira de Dermatologia"
      "documento" => "article"
      "crossmark" => 1
      "licencia" => "http://creativecommons.org/licenses/by/4.0/"
      "subdocumento" => "fla"
      "abierto" => array:3 [
        "ES" => true
        "ES2" => true
        "LATM" => true
      ]
      "gratuito" => true
      "lecturas" => array:1 [
        "total" => 0
      ]
      "pt" => array:12 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Artigo original</span>"
        "titulo" => "Sub&#8208;regula&#231;&#227;o do miR&#8208;181a atenua o estresse oxidativo induzido por H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> e a senesc&#234;ncia celular atuando sobre PDIA6 em fibroblastos do prep&#250;cio humano"
        "tienePdf" => "pt"
        "tieneTextoCompleto" => "pt"
        "tieneResumen" => "pt"
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "17"
            "paginaFinal" => "25"
          ]
        ]
        "contieneResumen" => array:1 [
          "pt" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "pt" => true
        ]
        "contienePdf" => array:1 [
          "pt" => true
        ]
        "resumenGrafico" => array:2 [
          "original" => 0
          "multimedia" => array:7 [
            "identificador" => "fig0015"
            "etiqueta" => "Figura 3"
            "tipo" => "MULTIMEDIAFIGURA"
            "mostrarFloat" => true
            "mostrarDisplay" => false
            "figura" => array:1 [
              0 => array:4 [
                "imagen" => "gr3.jpeg"
                "Alto" => 4175
                "Ancho" => 2773
                "Tamanyo" => 733021
              ]
            ]
            "descripcion" => array:1 [
              "pt" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">O <span class="elsevierStyleItalic">knockdown</span> de PDIA6 reverte o impacto supressivo mediado pelo inibidor de miR&#8208;181a na senesc&#234;ncia celular e no estresse oxidativo&#46; &#40;A&#41; An&#225;lise de RT&#8208;qPCR da express&#227;o de PDIA6 em FPH transfectados com sh&#8208;PDIA6&#46; &#40;B&#8211;C&#41; <span class="elsevierStyleItalic">Western blotting</span> da express&#227;o da prote&#237;na PDIA6 em FPH transfectados&#46; &#40;D&#41; Ensaio CCK&#8208;8 para avaliar a viabilidade de FPH com transfec&#231;&#227;o de inibidor de miR&#8208;181a&#44; inibidor de miR&#8208;181a<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>sh&#8208;PDIA6 ou miR&#8208;NC&#46; &#40;E&#8211;F&#41; Colora&#231;&#227;o para SA&#8208;&#946;&#8208;gal para avaliar a porcentagem de c&#233;lulas de FPH positivas para SA&#8208;&#946;&#8208;gal com a transfec&#231;&#227;o acima&#46; As imagens das c&#233;lulas foram fotografadas com aumento de 50<span class="elsevierStyleHsp" style=""></span>&#215;<span class="elsevierStyleHsp" style=""></span>&#46; &#40;G&#8211;J&#41;&#44; <span class="elsevierStyleItalic">Western blotting</span> para detectar a concentra&#231;&#227;o de marcadores de senesc&#234;ncia em FPH com a transfec&#231;&#227;o acima&#46; &#40;K&#8211;M&#41;&#44; Mensura&#231;&#227;o das atividades de SOD&#44; GPx e CAT em FPH transfectados com inibidor de miR&#8208;181a&#44; inibidor de miR&#8208;181a<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>sh&#8208;PDIA6 ou miR&#8208;NC&#46; &#42;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;05&#44; &#42;&#42;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;01&#44; &#42;&#42;&#42;p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;001&#46;</p>"
            ]
          ]
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Yan Huang, Huimin Yan, Yanqing Yang, Jinfei Zhou, Qijun Xu, Meng Hu"
            "autores" => array:6 [
              0 => array:2 [
                "nombre" => "Yan"
                "apellidos" => "Huang"
              ]
              1 => array:2 [
                "nombre" => "Huimin"
                "apellidos" => "Yan"
              ]
              2 => array:2 [
                "nombre" => "Yanqing"
                "apellidos" => "Yang"
              ]
              3 => array:2 [
                "nombre" => "Jinfei"
                "apellidos" => "Zhou"
              ]
              4 => array:2 [
                "nombre" => "Qijun"
                "apellidos" => "Xu"
              ]
              5 => array:2 [
                "nombre" => "Meng"
                "apellidos" => "Hu"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "pt"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S0365059622002227"
          "doi" => "10.1016/j.abd.2021.12.007"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => false
            "ES2" => false
            "LATM" => false
          ]
          "gratuito" => false
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002227?idApp=UINPBA00008Z"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275222002375?idApp=UINPBA00008Z"
      "url" => "/26662752/0000009800000001/v1_202301090939/S2666275222002375/v1_202301090939/pt/main.assets"
    ]
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S0365059622002203"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2021.12.005"
    "estado" => "S300"
    "fechaPublicacion" => "2023-01-01"
    "aid" => "632"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Inhibition of ANGPT2 activates autophagy during hypertrophic scar formation via PI3K&#47;AKT&#47;mTOR pathway"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "26"
          "paginaFinal" => "35"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0020"
          "etiqueta" => "Figure 4"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr4.jpeg"
              "Alto" => 4171
              "Ancho" => 3341
              "Tamanyo" => 876100
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0020"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">The effects of ANGPT2 knockdown on the proliferation and migration of HSFs as well as ECM accumulation&#46;</span> &#40;A&#41; CCK-8 assay was conducted to examine the proliferation of HSFs in Blank&#44; sh-NC&#44; sh-ANGPT2&#44; and sh-ANGPT2&#43;MHY1485 groups&#46; &#40;B&#8210;C&#41; Transwell assay was applied to assess the migration of HSFs in the above four groups&#46; &#40;D&#41; Levels of migration-related proteins in the above four groups were measured by western blotting&#46; &#40;E&#41; Western blotting was carried out to evaluate the expression of ECM-related proteins in the above four groups&#46; &#42;p&#160;&#60;&#160;0&#46;05&#44; &#42;&#42;p&#160;&#60;&#160;0&#46;01&#44; &#42;&#42;&#42;p&#160;&#60;&#160;0&#46;001&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Hongxin Chen, Kai Xu, Chao Sun, Si Gui, Juanjuan Wu, Song Wang"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Hongxin"
              "apellidos" => "Chen"
            ]
            1 => array:2 [
              "nombre" => "Kai"
              "apellidos" => "Xu"
            ]
            2 => array:2 [
              "nombre" => "Chao"
              "apellidos" => "Sun"
            ]
            3 => array:2 [
              "nombre" => "Si"
              "apellidos" => "Gui"
            ]
            4 => array:2 [
              "nombre" => "Juanjuan"
              "apellidos" => "Wu"
            ]
            5 => array:2 [
              "nombre" => "Song"
              "apellidos" => "Wang"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275222002351"
        "doi" => "10.1016/j.abdp.2022.10.001"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275222002351?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002203?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000001/v2_202304080751/S0365059622002203/v2_202304080751/en/main.assets"
  ]
  "itemAnterior" => array:18 [
    "pii" => "S0365059622002471"
    "issn" => "03650596"
    "doi" => "10.1016/j.abd.2022.01.012"
    "estado" => "S300"
    "fechaPublicacion" => "2023-01-01"
    "aid" => "659"
    "copyright" => "Sociedade Brasileira de Dermatologia"
    "documento" => "article"
    "crossmark" => 1
    "subdocumento" => "fla"
    "abierto" => array:3 [
      "ES" => false
      "ES2" => false
      "LATM" => false
    ]
    "gratuito" => false
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
      "titulo" => "Analysis of the autoimmune response to BP180 in Chinese stroke patients"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "13"
          "paginaFinal" => "16"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1417
              "Ancho" => 2175
              "Tamanyo" => 149167
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0030"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">ELISA results in the stroke and control groups&#46; Dots indicate the index value of each sample&#46; &#40;A&#41; Anti-BP180 antibody values of 1183 stroke patients and 855 controls&#46; The dotted lines represent the cutoff value of 20 RU&#47;mL&#46; &#40;B&#41; Anti-BP180 antibody-positive values of 148 stroke patients and 40 controls&#46; Black lines represent the median&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Jing Wang, Hong Liu, Zhenzhen Wang, Qing Pan, Furen Zhang"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "Jing"
              "apellidos" => "Wang"
            ]
            1 => array:2 [
              "nombre" => "Hong"
              "apellidos" => "Liu"
            ]
            2 => array:2 [
              "nombre" => "Zhenzhen"
              "apellidos" => "Wang"
            ]
            3 => array:2 [
              "nombre" => "Qing"
              "apellidos" => "Pan"
            ]
            4 => array:2 [
              "nombre" => "Furen"
              "apellidos" => "Zhang"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "pt" => array:9 [
        "pii" => "S2666275222002612"
        "doi" => "10.1016/j.abdp.2022.11.022"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "pt"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2666275222002612?idApp=UINPBA00008Z"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002471?idApp=UINPBA00008Z"
    "url" => "/03650596/0000009800000001/v2_202304080751/S0365059622002471/v2_202304080751/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>"
    "titulo" => "Downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence by targeting PDIA6 in human foreskin fibroblasts"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "17"
        "paginaFinal" => "25"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Yan Huang, Huimin Yan, Yanqing Yang, Jinfei Zhou, Qijun Xu, Hu Meng"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Yan"
            "apellidos" => "Huang"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Huimin"
            "apellidos" => "Yan"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Yanqing"
            "apellidos" => "Yang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Jinfei"
            "apellidos" => "Zhou"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Qijun"
            "apellidos" => "Xu"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "Hu"
            "apellidos" => "Meng"
            "email" => array:1 [
              0 => "humeng7622@163.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Wuhan Third Hospital&#44; Department of Plastic Surgery&#44; Hubei&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Xiangyang Yilaimei Medical Beauty Clinic&#44; Department of Aesthetic Dermatology&#44; Hubei&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 4175
            "Ancho" => 2773
            "Tamanyo" => 678384
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0110"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">PDIA6 knockdown reverses miR-181a inhibitor-mediated suppressive impact on cellular senescence and oxidative stress&#46;</span> &#40;A&#41; RT-qPCR analysis of PDIA6 expression in sh-PDIA6-transfected HFF&#46; &#40;B&#8210;C&#41; Western blotting of PDIA6 protein expression in transfected HFF&#46; &#40;D&#41; CCK-8 assay for evaluating the viability of HFF with transfection of miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#40;E&#8210;F&#41; SA-&#946;-gal staining for assessing the percentage of SA-&#946;-gal positive cells of HFF with above transfection&#46; Cell pictures were imaged at 50&#215; magnification&#46; &#40;G&#8210;J&#41; Western blotting for detecting concentration of senescence markers in HFF with above transfection&#46; &#40;K&#8210;M&#41; Measurement of the activities of SOD&#44; GPx and CAT in HFF transfected with miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#42;p &#60; 0&#46;05&#44; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Cellular senescence is a process comprised of irreversible growth arrest which is regarded as one of the hallmarks of aging&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> Cellular senescence in the skin leads to skin aging which can be induced by both extrinsic and intrinsic factors&#46;<a class="elsevierStyleCrossRefs" href="#bib0010"><span class="elsevierStyleSup">2&#44;3</span></a> Senescent cells can be detected with many hallmarks&#44; such as enhanced activity of senescence-associated &#946;-galactosidase &#40;SA-&#946;-gal&#41;&#44; elevated levels of tumor suppressor p53&#44; cyclin-dependent kinase &#40;CDK&#41; inhibitor p21 and senescence marker protein 30 &#40;SMP30&#41;&#46;<a class="elsevierStyleCrossRefs" href="#bib0020"><span class="elsevierStyleSup">4&#44;5</span></a> Numerous studies have indicated that oxidative stress contributes to skin aging and dermal damage&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Oxidative stress is a physiological process resulting from reactive oxygen &#40;ROS&#41; or nitrogen species&#44; including hydrogen peroxide &#40;H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#41; and superoxide anion &#40;O<span class="elsevierStyleSup">2&#8722;</span>&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> The skin has an antioxidative defense system&#44; including the enzymatic antioxidants like superoxide dismutase &#40;SOD&#41;&#44; glutathione peroxidase &#40;GPx&#41;&#44; and catalase &#40;CAT&#41;&#44; which helps to eliminate excessive ROS&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> SOD converts O<span class="elsevierStyleSup">2&#8722;</span> into H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2&#44;</span> while GPx and CAT convert H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> into water&#46;<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9&#44;10</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">It has been elucidated that microRNAs &#40;miRNAs&#41;&#44; endogenous noncoding RNAs of 18&#8211;24 nucleotides&#44; are implicated in a variety of biological processes&#46;<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11&#44;12</span></a> MiRNAs can bind to messenger RNA &#40;mRNA&#41; 3&#8217; untranslated regions &#40;3&#8217;UTRs&#41; and regulate gene expression post-transcriptionally&#46;<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a> Multiple miRNAs have been indicated to play an important role in cellular senescence in the skin&#46; For example&#44; miR-217 facilitates senescence in human skin fibroblasts by binding to DNMT1&#46;<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a> MiR-20a-3p is overexpressed in senescent fibroblasts and leads to cellular senescence by targeting HAS2&#46;<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> Importantly&#44; miR-181a was also demonstrated to be involved in cellular senescence&#46; For example&#44; miR-181a is upregulated during the senescence of human dermal fibroblasts which subsequently induces cellular senescence in early-passage cells&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> Furthermore&#44; downregulated miR-181a was shown to attenuate oxidative stress in myocardial injury by interacting with XIAP&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> Nevertheless&#44; the potential mechanism of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence is unclear&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">Protein disulfide isomerase family A member 6 &#40;PDIA6&#44; also known as P5&#41; catalyzes protein folding and displays isomerase and chaperone activities&#46; <a class="elsevierStyleCrossRef" href="#bib0090"><span class="elsevierStyleSup">18</span></a> Intriguingly&#44; a previous study demonstrated that PDIA6 is downregulated during cellular senescence in BMSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> In addition&#44; PDIA6&#44; localized in mitochondria&#44; was shown to inhibit cell death caused by oxidative stress&#46;<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> However&#44; whether PDIA6 exerts an effect on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence in human foreskin fibroblasts &#40;HFF&#41; is unknown&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">In this study&#44; the authors intended to explore the role and mechanism of miR-181a underlying H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF&#46; The results might help to develop a new perspective for ameliorating skin aging&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Cell culture</span><p id="par0025" class="elsevierStylePara elsevierViewall">HFF obtained from the cell bank of the chinese academy of sciences &#40;Shanghai&#44; China&#41; were incubated in Dulbecco&#39;s modified Eagle&#8217;s medium &#40;DMEM&#44; Invitrogen&#44; Carlsbad&#44; CA&#44; USA&#41; containing 10&#37; fetal bovine serum &#40;Gibco&#44; Grand Island&#44; NY&#44; USA&#41; and 1&#37; sodium pyruvate &#40;Invitrogen&#41; in a humidified incubator with at 37 &#176;C with 5&#37; CO<span class="elsevierStyleInf">2</span>&#46; After being grown to 80&#37; confluence&#44; cells in the logarithmic phase of growth were inoculated into 96-well plates &#40;10<span class="elsevierStyleSup">4</span> cells&#47;well&#41; and further cultured for 24 h&#46; Then&#44; the culture medium was removed and replaced with DMEM containing 1&#37; FBS&#46; After 24 h of incubation&#44; 0 or 200 &#956;M H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> was added to the medium and maintained for 6 h to establish control HFF or H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced HFF&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Cell transfection</span><p id="par0030" class="elsevierStylePara elsevierViewall">MiR-181a inhibitor and miR-NC were purchased from GenePharma &#40;Shanghai&#44; China&#41; and were transfected into HFF &#40;50 nM&#41; for inhibiting miR-181a&#46; Short hairpin RNA specifically targeting PDIA6 &#40;sh-PDIA6&#41;&#44; and control sh-NC also purchased from GenePharma were transfected into HFF &#40;2 &#956;g&#47;&#956;L&#41; for downregulating PDIA6&#46; Cell transfection was achieved by lipofectamine 2000 &#40;Invitrogen&#41; following the manufacturer&#8217;s recommendations&#46; After 48 h&#44; the transfection efficiency was assessed by RT-qPCR&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Cell counting Kit-8 &#40;CCK-8&#41; assay</span><p id="par0035" class="elsevierStylePara elsevierViewall">After H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment and&#47;or indicated transfection&#44; 10 &#956;L of CCK-8 solution &#40;Dojindo&#44; Kumamoto&#44; Japan&#41; was added to the medium&#44; and HFF were cultured at 37 &#176;C for another 2 h&#46; Then&#44; a microplate reader &#40;Molecular Devices&#44; Shanghai&#44; China&#41; was utilized for measuring the absorbance at 450 nm according to the manufacturer&#8217;s instructions&#46; All experiments were performed thrice&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Reverse transcription-quantitative polymerase chain reaction &#40;RT-qPCR&#41;</span><p id="par0040" class="elsevierStylePara elsevierViewall">Total RNA was isolated from HFF using TRIzol reagent &#40;Invitrogen&#41;&#46; Synthesis of cDNA was achieved by reverse transcription of total RNA using PrimeScript&#8482; RT reagent Kit &#40;Takara&#44; Dalian&#44; China&#41;&#46; RT-qPCR was implemented using SYBR&#174; Premix Ex Taq&#8482; II &#40;Takara&#41; on a CFX96&#8482; Real-Time System &#40;Bio-Rad&#44; Hercules&#44; CA&#44; USA&#41;&#46; The relative expression levels of miR-181a and its downstream targets were calculated with the 2<span class="elsevierStyleSup">&#8722;&#916;&#916;Ct</span> method&#44; with U6 and GAPDH as normalization&#44; respectively&#46; All experiments were performed in triplicate&#46; Primer sequences are listed in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Western blotting</span><p id="par0045" class="elsevierStylePara elsevierViewall">HFF were lysed in RIPA buffer &#40;Cell Signaling&#44; Danvers&#44; MA&#44; USA&#41; and the concentration of proteins was measured by a BCA kit &#40;Bio-Rad&#41;&#46; Protein samples &#40;20 &#956;g&#41; were separated by 10&#37; SDS-PAGE gels&#44; transferred to polyvinylidene fluoride &#40;PVDF&#41; membranes &#40;Millipore&#44; Billerica&#44; MA&#44; USA&#41;&#44; and blocked with 5&#37; non-fat milk&#46; Afterwards&#44; the membranes were incubated at 4 &#176;C overnight with primary antibodies as follows&#58; anti-p21 &#40;ab109520&#44; 1&#58;1000&#41;&#44; anti-p53 &#40;ab32389&#44; 1&#58;10000&#41;&#44; anti-SMP30 &#40;ab233007&#44; 1&#58;400&#41;&#44; anti-beta-actin &#40;ab115777&#44; 1&#58;200&#41;&#44; anti-PDIA6 &#40;ab154820&#44; 1&#58;1000&#41; &#40;all from Abcam&#44; Cambridge&#44; MA&#44; USA&#41; followed by incubation with secondary antibody &#40;ab97080&#44; Abcam&#41; for 1 h at room temperature&#46; Beta-actin was used as a loading control&#46; The proteins were visualized with an ECL system &#40;Bio-Rad&#41; and quantified by ImageJ software &#40;National Institutes of Health&#44; Bethesda&#44; MD&#44; USA&#41;&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">SA-&#946;-gal staining</span><p id="par0050" class="elsevierStylePara elsevierViewall">HFF were washed with PBS and fixed in 3&#37; formaldehyde at room temperature for 15 min&#46; After washing with PBS twice&#44; HFF were incubated overnight at 37 &#176;C with &#946;-galactosidase staining reagents &#40;1 mg&#47;mL X-gal&#44; 2 mM MgCl<span class="elsevierStyleInf">2</span>&#44; 150 mM NaCl&#44; pH 6&#46;0&#44; 5 mM potassium ferrocyanide&#44; 5 mM potassium ferricyanide and 40 nM citric acid&#47;sodium phosphate&#58; Beyotime&#44; Shanghai&#44; China&#41;&#46; Eventually&#44; stained HFF were imaged with a light microscope &#40;Nikon&#44; Tokyo&#44; Japan&#41; at 50&#215; magnification&#44; and the percentage of positive cells were analyzed with Image-Pro Plus 6&#46;0 &#40;Media Cybernetics&#44; Silver Spring&#44; MD&#44; USA&#41;&#46; All experiments were performed three times&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Detection of SOD&#44; GPx and CAT activities</span><p id="par0055" class="elsevierStylePara elsevierViewall">The activities of SOD&#44; GPx and CAT were measured as previously described&#46;<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> Briefly&#44; one unit of SOD was defined as the amount of enzyme that suppressed 50&#37; of the formazan&#47;min&#46; Xanthine and xanthine oxidase were utilized to produce superoxide anions&#46; The reaction between superoxide anions and tetrasodium chloride formed yellow formazan whose absorption was evaluated at 450 nm&#46; For GPx&#44; enzymatic reactions in tubes containing reduced glutathione&#44; glutathione reductase and NADPH&#44; were initiated by adding cumene hydroperoxide&#46; GPx activity was measured with a wavelength of 340 nm&#46; For CAT activity&#44; one unit of CAT was defined as the amount of enzyme that decomposed 1 M of H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#47;min&#46; The rate of decomposition of H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> was assessed at 570 nm&#46; The SOD&#44; GPx and CAT assay kits &#40;Jiancheng Bioengineering Institute&#44; Nanjing&#44; China&#41; were used for spectrophotometrically detecting the enzyme activities which were expressed as U&#47;mg of protein&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Luciferase reporter assay</span><p id="par0060" class="elsevierStylePara elsevierViewall">The complementary binding site of miR-181a on PDIA6 3&#8217;UTR was predicted by TargetScan &#40;<a href="http://www.targetscan.org/vert_71/">http&#58;&#47;&#47;www&#46;targetscan&#46;org&#47;vert&#95;71&#47;</a>&#41;&#46; The wild-type or mutant sequences of PDIA6 3&#8217;UTR were subcloned into pmirGLO vectors &#40;Promega&#44; Madison&#44; WI&#44; USA&#41; to establishPDIA6-Wt&#47;Mut&#46; Afterward&#44; these vectors were co-transfected into HFF with miR-181a inhibitor or miR-NC using Lipofectamine 2000 &#40;Invitrogen&#41;&#46; After 48 h of transfection&#44; the luciferase activity was evaluated by a dual-luciferase reporter kit &#40;Promega&#41;&#44; normalized to Renilla luciferase activity&#46; All experiments were performed in triplicate&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Statistical analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">SPSS 18&#46;0 &#40;SPSS&#44; Chicago&#44; IL&#44; USA&#41; was utilized for statistical analysis&#46; Data are presented as the mean &#177; standard deviation&#46; Differences between two groups were analyzed by Student&#8217;s <span class="elsevierStyleItalic">t</span>-test while those among more than two groups were assessed by analysis of variance &#40;ANOVA&#41; followed by Tukey&#8217;s <span class="elsevierStyleItalic">post-hoc</span> analysis&#46; Each experiment was repeated at least three times&#46; The value of p &#60; 0&#46;05 was considered significant&#46;</p></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Results</span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Downregulation of miR-181a mitigates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence and oxidative stress</span><p id="par0070" class="elsevierStylePara elsevierViewall">First&#44; the authors detected miR-181a levels in HFF by RT-qPCR&#46; Relative to the control group&#44; miR-181a level was increased in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF and was reduced after transfection of miR-181a inhibitor &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>A&#41;&#46; Next&#44; the impact of miR-181a on the viability of HFF was assessed&#46; As revealed by CCK-8 assay&#44; H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment markedly reduced the viability of HFF&#44; while miR-181a depletion attenuated this effect &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>B&#41;&#44; suggesting that downregulated miR-181a might protect HFF against H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cell damage&#46; Moreover&#44; detection of SA-&#946;-gal activity displayed that miR-181a inhibition led to a reduction in the H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced increased percentage of SA-&#946;-gal positive cells &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>C&#41;&#46; A similar trend was observed in the results of western blotting&#46; Protein levels of senescence markers &#40;p21&#44; p53 and SMP30&#41; were significantly raised by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment in HFF compared to the control groups and were then decreased by miR-181a inhibitor &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>D&#8210;G&#41;&#46; The above results indicated that downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence in HFF&#46; Subsequently&#44; the authors tested whether miR-181a had an impact on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress&#46; As shown by Figure 1 H&#8210;J&#44; H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment markedly elevated the activity of SOD&#44; GPx&#44; and CAT&#44; which was partially reversed after the downregulation of miR-181a in HFF&#46; The results suggested that the antioxidant enzymes actively respond to oxidative stress and miR-181a inhibition can relieve H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">MiR-181a targets PDIA6</span><p id="par0075" class="elsevierStylePara elsevierViewall">As shown in Figure 2A&#44; four downstream targets of miR-181a were screened out by ENCORI &#40;<a href="https://starbase.sysu.edu.cn/">https&#58;&#47;&#47;starbase&#46;sysu&#46;edu&#46;cn&#47;</a>&#41; with the condition of a number of supported AGO CLIP-seq experiments &#40;AgoExpNum&#41; &#8805;40&#46; Results from RT-qPCR showed that after inhibiting miR-181a in HFF&#44; only the PDIA6 level was significantly enhanced &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>B&#41;&#46; Likewise&#44; western blotting displayed that miR-181a inhibitor increased the protein level of PDIA6 in HFF &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>C&#41;&#46; The existence of putative complementary site between miR-181a and PDIA6 was predicted by TargetScan &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>D&#41;&#46; Moreover&#44; the luciferase activity of PDIA6-Wt was upregulated in HFF after transfection of miR-181a inhibitor&#44; while that of PDIA6-Mut was not significantly influenced&#44; as shown by luciferase reporter assay &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>E&#41;&#46; Notably&#44; RT-qPCR and western blotting demonstrated that mRNA and protein expression of PDIA6 was markedly downregulated in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF compared with the control group &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>F&#8210;H&#41;&#46; Collectively&#44; PDIA6 is a target for miR-181a in HFF&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">PDIA6 knockdown reverses miR-181a inhibition-mediated suppressive impact on cellular senescence and oxidative stress</span><p id="par0080" class="elsevierStylePara elsevierViewall">To investigate the impact of PDIA6 on cellular senescence in HFF&#44; the authors first transfected sh-PDIA6 into HFF&#46; The mRNA and protein expression levels of PDIA6 were decreased in HFF transfected with sh-PDIA6&#44; as displayed by RT-qPCR and western blotting&#44; respectively &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A&#8210;C&#41;&#46; CCK-8 assay revealed that miR-181a inhibitor promoted the viability of HFF while co-transfection of sh-PDIA6 attenuated this effect &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>D&#41;&#46; Additionally&#44; results from SA-&#946;-gal staining displayed that depletion of miR-181a significantly reduced the percentage of SA-&#946;-gal positive cells&#44; which was partially reversed by knocking down miR-181a and PDIA6 simultaneously &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>E&#8210;F&#41;&#46; This was consistent with western blotting which showed that knocking down PDIA6 rescued the reduction in senescence marker protein levels caused by miR-181a inhibitor in HFF &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>G&#8210;J&#41;&#46; Hence&#44; it was suggested by the above results that downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-mediated cellular senescence by targeting PDIA6&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">Then&#44; the authors tested whether miR-181a exerted its influence on oxidative stress by regulating PDIA6&#46; As exhibited by the results&#44; knocking down PDIA6 alleviated the suppressive effect on SOD&#44; GPx and CAT activities in HFF resulting from miR-181a inhibitor &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>K&#8210;M&#41;&#46; This revealed that downregulated miR-181a alleviates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress by targeting PDIA6&#46;</p></span></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Discussion</span><p id="par0090" class="elsevierStylePara elsevierViewall">The damage resulting from decreased antioxidant ability and imbalance of the oxidative system is termed oxidative stress&#46;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> Emerging evidence has suggested that oxidative stress in the skin is a key cause of cellular senescence&#44; consequently leading to skin aging&#46;<a class="elsevierStyleCrossRefs" href="#bib0115"><span class="elsevierStyleSup">23&#44;24</span></a> Previous studies have elucidated that aging and ultraviolet B &#40;UVB&#41; exposure are strongly correlated with the high risk of skin cancer&#46;<a class="elsevierStyleCrossRefs" href="#bib0125"><span class="elsevierStyleSup">25&#44;26</span></a> It is suggested that an increased presence of senescent fibroblasts in geriatric skin causes the silencing of insulin-like growth factor 1 &#40;IGF-1&#41; expression in the skin&#46;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> The silencing of IGF-1 in senescent fibroblasts results in an inappropriate UVB-response and the proliferation of keratinocytes containing DNA damage&#44; which ultimately leads to photocarcinogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> Hence&#44; finding an effective approach to alleviate cellular senescence might help to reduce skin carcinogenic risk&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">Numerous studies have demonstrated the significant effects of miRNAs involved in oxidative stress and cellular senescence&#44; such as miR-1445-5p&#44; miR-570&#44; and miR-93-5p&#46;<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">28&#8211;30</span></a> Previous studies have verified that miR-181a plays a crucial role in cellular senescence&#46;<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">31</span></a> MiR-181a was reported to exhibit elevated expression in keratinocytes during replicative senescence&#44; suggesting that overexpressed miR-181a might play a promotive role in cellular senescence&#46;<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a> In this study&#44; the authors examined the role of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#46; Senescent cells are characterized by cell growth arrest and abnormal gene expression&#46;<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">33</span></a> Thus&#44; the role of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF was identified by detecting its influences on cell viability&#44; SA-&#946;-gal staining&#44; and expression levels of senescence markers&#46; It was revealed that downregulated miR-181a could enhance cell viability and suppress cellular senescence caused by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> in HFF&#46; Furthermore&#44; to detect the impact of miR-181a on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress&#44; the authors assessed the activities of the antioxidants &#40;SOD&#44; GPx and CAT&#41; which are key regulators in the oxidative system&#46; It was found that miR-181a inhibition significantly decreased the antioxidant abilities in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#44; indicating that knocking down miR-181a is able to suppress oxidative stress induced by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">MiRNAs are recognized to modulate the expression of downstream targets by base-pairing to the sequences of mRNA 3&#8217;UTRs&#46;<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">34</span></a> To figure out how miR-181a exerts its influences on oxidative stress and cellular senescence&#44; the bioinformatics tool ENCORI was utilized for screening the downstream targets of miR-181a&#46; Among the selected mRNAs&#44; the authors finally identified PDIA6 as the target gene of miR-181a&#46; PDIA6&#44; a member of the disulfide isomerase family&#44; is implicated in various human diseases&#44; such as diabetes mellitus&#44; liver fibrosis&#44; and various cancers&#46;<a class="elsevierStyleCrossRefs" href="#bib0175"><span class="elsevierStyleSup">35&#44;36</span></a> Additionally&#44; a previous study suggested that PDIA6 is closely related to cellular senescence in human BMSCs&#46;<a class="elsevierStyleCrossRef" href="#bib0095"><span class="elsevierStyleSup">19</span></a> In the present study&#44; PDIA6 exhibited decreased expression in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF in comparison to the control group&#46; Intriguingly&#44; miR-181a inhibition alleviated H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>- induced oxidative stress in HFF and cellular senescence&#44; and knocking down PDIA6 reversed the inhibitory impact on cellular senescence and oxidative stress mediated by downregulated miR-181a&#46; This suggested that silencing miR-181a mitigated H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence and oxidative stress by targeting PDIA6&#44; and PDIA6 might protect HFF from cellular senescence induced by H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Conclusion</span><p id="par0105" class="elsevierStylePara elsevierViewall">In conclusion&#44; the potential role and mechanism of miR-181a in regulating H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF were investigated&#46; The results revealed that downregulated miR-181a can ameliorate H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF by regulating PDIA6&#46; The present findings might help to develop a new perspective for improving skin aging and senescence-associated disorders&#46;</p></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Financial support</span><p id="par0110" class="elsevierStylePara elsevierViewall">The study was supported by the M<span class="elsevierStyleGrantSponsor" id="gs0005">edical Science Research Project of the Wuhan Municipal Health Commission</span> &#40;grant n&#186; <span class="elsevierStyleGrantNumber" refid="gs0005">WX20Q03&#41;</span>&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Author&#39;s contribution</span><p id="par0115" class="elsevierStylePara elsevierViewall">Yan Huang&#58; Critical literature review&#59; data collection&#59; effective participation in research orientation&#59; intellectual participation in propaedeutic and&#47;or therapeutic management of studied cases&#59; manuscript critical review&#59; preparation and writing of the manuscript&#59; statistical analysis&#59; study conception and planning&#59; approval of the final version of the manuscript&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">Huimin Yan&#58; Critical literature review&#59; data collection&#59; analysis and interpretation&#59; effective participation in research orientation&#59; intellectual participation in propaedeutic and&#47;or therapeutic management of studied cases&#59; manuscript critical review&#59; preparation and writing of the manuscript&#59; statistical analysis&#59; study conception and planning&#59; approval of the final version of the manuscript&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">Yanqing Yang&#58; Data collection&#59; analysis and interpretation&#59; approval of the final version of the manuscript&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">Jinfei Zhou&#58; Data collection&#59; analysis and interpretation&#59; approval of the final version of the manuscript&#46;</p><p id="par0135" class="elsevierStylePara elsevierViewall">Qijun Xu&#58; Effective participation in research orientation&#59; statistical analysis&#59; approval of the final version of the manuscript&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">Meng Hu&#58; Critical literature review&#59; data collection&#59; analysis and interpretation&#59; effective participation in research orientation&#59; intellectual participation in propaedeutic and&#47;or therapeutic management of studied cases&#59; manuscript critical review&#59; preparation and writing of the manuscript&#59; statistical analysis&#59; approval of the final version of the manuscript&#46;</p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Conflicts of interest</span><p id="par0145" class="elsevierStylePara elsevierViewall">None declared&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:11 [
        0 => array:3 [
          "identificador" => "xres1881234"
          "titulo" => "Abstract"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Objective"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Study limitations"
            ]
            5 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1630586"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:9 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Cell culture"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Cell transfection"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Cell counting Kit-8 &#40;CCK-8&#41; assay"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Reverse transcription-quantitative polymerase chain reaction &#40;RT-qPCR&#41;"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Western blotting"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "SA-&#946;-gal staining"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Detection of SOD&#44; GPx and CAT activities"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Luciferase reporter assay"
            ]
            8 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:3 [
          "identificador" => "sec0060"
          "titulo" => "Results"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Downregulation of miR-181a mitigates HO-induced cellular senescence and oxidative stress"
            ]
            1 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "MiR-181a targets PDIA6"
            ]
            2 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "PDIA6 knockdown reverses miR-181a inhibition-mediated suppressive impact on cellular senescence and oxidative stress"
            ]
          ]
        ]
        5 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Conclusion"
        ]
        7 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Financial support"
        ]
        8 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Author&#39;s contribution"
        ]
        9 => array:2 [
          "identificador" => "sec0100"
          "titulo" => "Conflicts of interest"
        ]
        10 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2021-10-26"
    "fechaAceptado" => "2021-12-03"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1630586"
          "palabras" => array:3 [
            0 => "Cellular senescence"
            1 => "Oxidative stress"
            2 => "Protein disulfide-isomerases"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Oxidative stress is strongly associated with cellular senescence&#46; Numerous studies have indicated that microRNAs &#40;miRNAs&#41; play a critical part in cellular senescence&#46; MiR-181a was reported to induce cellular senescence&#44; however&#44; the potential mechanism of miR-181a in hydrogen peroxide &#40;H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#41;-induced cellular senescence remains obscure&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Objective</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">The aim of this study is to investigate the role and regulatory mechanism of miR-181a in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Human foreskin fibroblasts &#40;HFF&#41; transfected with miR-181a inhibitor&#47;miR-NC with or without H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> treatment were divided into four groups&#58; control &#43; miR-NC&#47;miR-181a inhibitor&#44; H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span> &#43; miR-NC&#47;miR-181a inhibitor&#46; CCK-8 assay was utilized to evaluate the viability of HFF&#46; RT-qPCR was used to measure the expression of miR-181a and its target genes&#46; Protein levels of protein disulfide isomerase family A member 6 &#40;PDIA6&#41; and senescence markers were assessed by western blotting&#46; Senescence-associated &#946;-galactosidase &#40;SA-&#946;-gal&#41; staining was applied for detecting SA-&#946;-gal activity&#46; The activities of SOD&#44; GPx&#44; and CAT were detected by corresponding assay kits&#46; The binding relation between PDIA6 and miR-181a was identified by luciferase reporter assay&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">MiR-181a inhibition suppressed H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF&#46; PDIA6 was targeted by miR-181a and lowly expressed in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#46; Knocking down PDIA6 reversed miR-181a inhibition-mediated suppressive impact on H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Study limitations</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Signaling pathways that might be mediated by miR-181a&#47;PDIA6 axis were not investigated&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Conclusion</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Downregulated miR-181a attenuates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced oxidative stress and cellular senescence in HFF by targeting PDIA6&#46;</p></span>"
        "secciones" => array:6 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Objective"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Study limitations"
          ]
          5 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "NotaPie" => array:2 [
      0 => array:2 [
        "etiqueta" => "&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Study conducted at the Wuhan Third Hospital&#44; Wuhan&#44; China&#46;</p>"
      ]
      1 => array:3 [
        "etiqueta" => "1"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0015">These authors contributed equally to the work&#46;</p>"
        "identificador" => "fn0005"
      ]
    ]
    "multimedia" => array:4 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 3658
            "Ancho" => 3341
            "Tamanyo" => 813397
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0100"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">MiR-181a depletion mitigates H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-induced cellular senescence and oxidative stress&#46;</span> Assays were conducted in HFF with different treatments &#40;with or without H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>&#59; transfection of miR-NC or miR-181a inhibitor&#41;&#46; &#40;A&#41; RT-qPCR analysis of miR-181a level&#46; &#40;B&#41; CCK-8 assay for evaluating cell viability&#46; &#40;C&#41; SA-&#946;-gal staining for assessing SA-&#946;-gal activity&#46; Cell pictures were imaged at 50&#215; magnification&#46; &#40;D&#8210;G&#41; Western blotting for measuring protein levels of senescence markers&#46; &#40;H&#8210;J&#41; Measurement of the activities of SOD&#44; GPx and CAT in HFF&#46; &#42;p &#60; 0&#46;05&#44; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 3121
            "Ancho" => 3341
            "Tamanyo" => 528405
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0105"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">MiR-181a binds with PDIA6&#46;</span> &#40;A&#41; Four downstream targets of miR-181a predicted by ENCORI&#46; &#40;B&#41; RT-qPCR analysis for assessing these mRNA levels in HFF transfected with miR-181a inhibitor&#46; &#40;C&#41; Western blotting of PDIA6 protein expression in miR-181a inhibitor-transfected HFF&#46; &#40;D&#41; The binding site of miR-181a on PDIA6 3&#8217;UTR predicted by TargetScan&#46; &#40;E&#41; Luciferase reporter assay for elucidating the binding relation between PDIA6 and miR-181a&#46; &#40;F&#41; RT-qPCR analysis of PDIA6 level in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF&#46; G&#8211;H&#46; Western blotting of PDIA6 protein level in H<span class="elsevierStyleInf">2</span>O<span class="elsevierStyleInf">2</span>-treated HFF and control group&#46; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 4175
            "Ancho" => 2773
            "Tamanyo" => 678384
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0110"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0015" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleBold">PDIA6 knockdown reverses miR-181a inhibitor-mediated suppressive impact on cellular senescence and oxidative stress&#46;</span> &#40;A&#41; RT-qPCR analysis of PDIA6 expression in sh-PDIA6-transfected HFF&#46; &#40;B&#8210;C&#41; Western blotting of PDIA6 protein expression in transfected HFF&#46; &#40;D&#41; CCK-8 assay for evaluating the viability of HFF with transfection of miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#40;E&#8210;F&#41; SA-&#946;-gal staining for assessing the percentage of SA-&#946;-gal positive cells of HFF with above transfection&#46; Cell pictures were imaged at 50&#215; magnification&#46; &#40;G&#8210;J&#41; Western blotting for detecting concentration of senescence markers in HFF with above transfection&#46; &#40;K&#8210;M&#41; Measurement of the activities of SOD&#44; GPx and CAT in HFF transfected with miR-181a inhibitor&#44; miR-181a inhibitor &#43; sh-PDIA6 or miR-NC&#46; &#42;p &#60; 0&#46;05&#44; &#42;&#42;p &#60; 0&#46;01&#44; &#42;&#42;&#42;p &#60; 0&#46;001&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0115"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence &#40;5&#8217;&#8594; 3&#8217;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">hsa-miR-181a-5p forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACACTCCAGCTGGGAACATTCAACGCTGTCGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">hsa-miR-181a-5p reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGGTGTCGTGGAGTCGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">PDIA6 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCCTGCCCACTCCCTATCAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">PDIA6 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAACTGTATCCTCCGCTCCG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TNPO1 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GACGCGCCTACGGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TNPO1 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGTTGCACGGTTCTCTGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HMGB2 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCCAACAGGCTCAAAGAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">HMGB2 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CACACATTCCACACGCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CBX4 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGGAGTATCTGGTGAAATGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CBX4 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACGACGGGCAAAGGTAGGCAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TGCACCACCAACTGCTTAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAPDH reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGCATGGACTGTGGTCATGAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U6 forward&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTCGCTTGGGCAGCACA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">U6 reverse&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AACGCTTCACGAATTTGCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Primer sequences used for RT-qPCR&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:36 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cellular senescence in development&#44; regeneration&#44; and disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Rhinn"
                            1 => "B&#46; Ritschka"
                            2 => "W&#46;M&#46; Keyes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Development&#46;"
                        "fecha" => "2019"
                        "paginaInicial" => "146"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The impact of cellular senescence in skin ageing&#58; a notion of mosaic and therapeutic strategies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46; Toutfaire"
                            1 => "E&#46; Bauwens"
                            2 => "F&#46; Debacq-Chainiaux"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bcp.2017.04.011"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Pharmacol&#46;"
                        "fecha" => "2017"
                        "volumen" => "142"
                        "paginaInicial" => "1"
                        "paginaFinal" => "12"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28408343"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cellular senescence&#58; what&#44; why&#44; and how"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46;J&#46; Regulski"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Wounds&#46;"
                        "fecha" => "2017"
                        "volumen" => "29"
                        "paginaInicial" => "168"
                        "paginaFinal" => "174"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28682291"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Techniques to induce and quantify cellular senescence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "N&#46; Noren Hooten"
                            1 => "M&#46;K&#46; Evans"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "J Vis Exp&#46;"
                        "fecha" => "2017"
                        "volumen" => "1"
                        "paginaInicial" => "55533"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "What is and what is not cell senescence"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "E&#46; Sikora"
                            1 => "A&#46; Bielak-&#379;mijewska"
                            2 => "G&#46; Mosieniak"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18388/pb.2018_120"
                      "Revista" => array:6 [
                        "tituloSerie" => "Postepy Biochem&#46;"
                        "fecha" => "2018"
                        "volumen" => "64"
                        "paginaInicial" => "110"
                        "paginaFinal" => "118"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30656893"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "How good is the evidence that cellular senescence causes skin ageing&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "E&#46; Low"
                            1 => "G&#46; Alimohammadiha"
                            2 => "L&#46;A&#46; Smith"
                            3 => "L&#46;F&#46; Costello"
                            4 => "S&#46;A&#46; Przyborski"
                            5 => "T&#46; von Zglinicki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Ageing Res Rev&#46;"
                        "fecha" => "2021"
                        "volumen" => "71"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oxidative stress down-regulates MiR-20b-5p&#44; MiR-106a-5p and E2F1 expression to suppress the G1&#47;S transition of the cell cycle in multipotent stromal cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "L&#46; Tai"
                            1 => "C&#46;J&#46; Huang"
                            2 => "K&#46;B&#46; Choo"
                            3 => "S&#46;K&#46; Cheong"
                            4 => "T&#46; Kamarul"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.7150/ijms.38832"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Med Sci&#46;"
                        "fecha" => "2020"
                        "volumen" => "17"
                        "paginaInicial" => "457"
                        "paginaFinal" => "470"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32174776"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Exogenous antioxidants-double-edged swords in cellular redox state&#58; health beneficial effects at physiologic doses versus deleterious effects at high doses"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46; Bouayed"
                            1 => "T&#46; Bohn"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4161/oxim.3.4.12858"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oxid Med Cell Longev&#46;"
                        "fecha" => "2010"
                        "volumen" => "3"
                        "paginaInicial" => "228"
                        "paginaFinal" => "237"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20972369"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Levels of selenium&#44; zinc&#44; copper&#44; and antioxidant enzyme activity in patients with leukemia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "X&#46;L&#46; Zuo"
                            1 => "J&#46;M&#46; Chen"
                            2 => "X&#46; Zhou"
                            3 => "X&#46;Z&#46; Li"
                            4 => "G&#46;Y&#46; Mei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Biol Trace Elem Res&#46;"
                        "fecha" => "2006"
                        "volumen" => "114"
                        "paginaInicial" => "41"
                        "paginaFinal" => "53"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Altered antioxidant capacity in human renal cell carcinoma&#58; role of glutathione associated enzymes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Pljesa-Ercegovac"
                            1 => "J&#46; Mimic-Oka"
                            2 => "D&#46; Dragicevic"
                            3 => "A&#46; Savic-Radojevic"
                            4 => "M&#46; Opacic"
                            5 => "S&#46; Pljesa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.urolonc.2007.02.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "Urol Oncol&#46;"
                        "fecha" => "2008"
                        "volumen" => "26"
                        "paginaInicial" => "175"
                        "paginaFinal" => "181"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18312938"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clustered miRNAs and their role in biological functions and diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "S&#46;P&#46; Kabekkodu"
                            1 => "V&#46; Shukla"
                            2 => "V&#46;K&#46; Varghese"
                            3 => "J&#46; D&#8217; Souza"
                            4 => "S&#46; Chakrabarty"
                            5 => "K&#46; Satyamoorthy"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/brv.12428"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biol Rev Camb Philos Soc&#46;"
                        "fecha" => "2018"
                        "volumen" => "93"
                        "paginaInicial" => "1955"
                        "paginaFinal" => "1986"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29797774"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evaluation of online miRNA resources for biomedical applications"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "N&#46;H&#46; Tan Gana"
                            1 => "A&#46;F&#46; Victoriano"
                            2 => "T&#46; Okamoto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/j.1365-2443.2011.01564.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genes Cells&#46;"
                        "fecha" => "2012"
                        "volumen" => "17"
                        "paginaInicial" => "11"
                        "paginaFinal" => "27"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22077698"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-based therapeutics in cardiovascular disease&#58; screening and delivery to the target"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "D&#46; Mellis"
                            1 => "A&#46; Caporali"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BST20170037"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Soc Trans&#46;"
                        "fecha" => "2018"
                        "volumen" => "46"
                        "paginaInicial" => "11"
                        "paginaFinal" => "21"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29196609"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Microrna-217 modulates human skin fibroblast senescence by directly targeting DNA methyltransferase 1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "B&#46; Wang"
                            1 => "R&#46; Du"
                            2 => "X&#46; Xiao"
                            3 => "Z&#46;L&#46; Deng"
                            4 => "D&#46; Jian"
                            5 => "H&#46;F&#46; Xie"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/oncotarget.16509"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncotarget&#46;"
                        "fecha" => "2017"
                        "volumen" => "8"
                        "paginaInicial" => "33475"
                        "paginaFinal" => "33486"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28380423"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-23a-3p causes cellular senescence by targeting hyaluronan synthase 2&#58; possible implication for skin aging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; R&#246;ck"
                            1 => "J&#46; Tigges"
                            2 => "S&#46; Sass"
                            3 => "A&#46; Sch&#252;tze"
                            4 => "A&#46;M&#46; Florea"
                            5 => "A&#46;C&#46; Fender"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/jid.2014.422"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Invest Dermatol&#46;"
                        "fecha" => "2015"
                        "volumen" => "135"
                        "paginaInicial" => "369"
                        "paginaFinal" => "377"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25264594"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-152 and -181a participate in human dermal fibroblasts senescence acting on cell adhesion and remodeling of the extra-cellular matrix"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Mancini"
                            1 => "G&#46; Saintigny"
                            2 => "C&#46; Mah&#233;"
                            3 => "M&#46; Annicchiarico-Petruzzelli"
                            4 => "G&#46; Melino"
                            5 => "E&#46; Candi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18632/aging.100508"
                      "Revista" => array:6 [
                        "tituloSerie" => "Aging &#40;Albany NY&#41;&#46;"
                        "fecha" => "2012"
                        "volumen" => "4"
                        "paginaInicial" => "843"
                        "paginaFinal" => "853"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23238588"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Downregulation of miR-181a-5p alleviates oxidative stress and inflammation in coronary microembolization-induced myocardial damage by directly targeting XIAP"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Y&#46; Zhou"
                            1 => "M&#46;Y&#46; Long"
                            2 => "Z&#46;Q&#46; Chen"
                            3 => "J&#46;W&#46; Huang"
                            4 => "Z&#46;B&#46; Qin"
                            5 => "L&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.11909/j.issn.1671-5411.2021.06.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Geriatr Cardiol&#46;"
                        "fecha" => "2021"
                        "volumen" => "18"
                        "paginaInicial" => "426"
                        "paginaFinal" => "439"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34220972"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A point mutation in the Pdia6 gene results in loss of pancreatic &#946;-cell identity causing overt diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46;F&#46; Chhabra"
                            1 => "A&#46;L&#46; Amend"
                            2 => "A&#46; Bastidas-Ponce"
                            3 => "S&#46; Sabrautzki"
                            4 => "M&#46; Tarquis-Medina"
                            5 => "S&#46; Sachs"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Mol Metab&#46;"
                        "fecha" => "2021"
                        "volumen" => "54"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Expression profiles of subtracted mRNAs during cellular senescence in human mesenchymal stem cells derived from bone marrow"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;K&#46; Yoo"
                            1 => "S&#46;J&#46; Choi"
                            2 => "J&#46;K&#46; Kim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.exger.2013.02.022"
                      "Revista" => array:6 [
                        "tituloSerie" => "Exp Gerontol&#46;"
                        "fecha" => "2013"
                        "volumen" => "48"
                        "paginaInicial" => "464"
                        "paginaFinal" => "471"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23466301"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mitochondrial P5&#44; a member of protein disulphide isomerase family&#44; suppresses oxidative stress-induced cell death"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Shitara"
                            1 => "Y&#46; Tonohora"
                            2 => "T&#46; Goto"
                            3 => "Y&#46; Yamada"
                            4 => "T&#46; Miki"
                            5 => "H&#46; Makino"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/jb/mvs034"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Biochem&#46;"
                        "fecha" => "2012"
                        "volumen" => "152"
                        "paginaInicial" => "73"
                        "paginaFinal" => "85"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22492663"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevention of oxidative stress in Chang liver cells by gallic acid-grafted-chitosans"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Senevirathne"
                            1 => "Y&#46;J&#46; Jeon"
                            2 => "Y&#46;T&#46; Kim"
                            3 => "P&#46;J&#46; Park"
                            4 => "W&#46;K&#46; Jung"
                            5 => "C&#46;B&#46; Ahn"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.carbpol.2011.08.080"
                      "Revista" => array:6 [
                        "tituloSerie" => "Carbohydr Polym&#46;"
                        "fecha" => "2012"
                        "volumen" => "87"
                        "paginaInicial" => "876"
                        "paginaFinal" => "880"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/34663049"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Oxidative stress&#58; oxidants and antioxidants"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "H&#46; Sies"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1113/expphysiol.1997.sp004024"
                      "Revista" => array:6 [
                        "tituloSerie" => "Exp Physiol&#46;"
                        "fecha" => "1997"
                        "volumen" => "82"
                        "paginaInicial" => "291"
                        "paginaFinal" => "295"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9129943"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "6&#44;4&#8217;-dihydroxy-7-methoxyflavanone protects against H&#40;2&#41;O&#40;2&#41;-induced cellular senescence by inducing SIRT1 and inhibiting phosphatidylinositol 3-kinase&#47;Akt pathway activation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "B&#46;S&#46; Li"
                            1 => "R&#46;Z&#46; Zhu"
                            2 => "B&#46;M&#46; Choi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s11010-020-03951-z"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Cell Biochem&#46;"
                        "fecha" => "2021"
                        "volumen" => "476"
                        "paginaInicial" => "863"
                        "paginaFinal" => "872"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33111210"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Biomarkers&#44; oxidative stress and autophagy in skin aging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Gu"
                            1 => "J&#46; Han"
                            2 => "C&#46; Jiang"
                            3 => "Y&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Ageing Res Rev&#46;"
                        "fecha" => "2020"
                        "volumen" => "59"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Impact of age and insulin-like growth factor-1 on DNA damage responses in UV-irradiated human skin"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;G&#46; Kemp"
                            1 => "D&#46;F&#46; Spandau"
                            2 => "J&#46;B&#46; Travers"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/molecules22030356"
                      "Revista" => array:5 [
                        "tituloSerie" => "Molecules&#46;"
                        "fecha" => "2017"
                        "volumen" => "22"
                        "paginaInicial" => "356"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28245638"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Randomized controlled trial of fractionated laser resurfacing on aged skin as prophylaxis against actinic neoplasia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46;F&#46; Spandau"
                            1 => "R&#46; Chen"
                            2 => "J&#46;J&#46; Wargo"
                            3 => "C&#46;A&#46; Rohan"
                            4 => "D&#46; Southern"
                            5 => "A&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "J Clin Invest&#46;"
                        "fecha" => "2021"
                        "volumen" => "131"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The IGF-1&#47;IGF-1R signaling axis in the skin&#58; a new role for the dermis in aging-associated skin cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "D&#46;A&#46; Lewis"
                            1 => "J&#46;B&#46; Travers"
                            2 => "A&#46;K&#46; Somani"
                            3 => "D&#46;F&#46; Spandau"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/onc.2009.440"
                      "Revista" => array:6 [
                        "tituloSerie" => "Oncogene&#46;"
                        "fecha" => "2010"
                        "volumen" => "29"
                        "paginaInicial" => "1475"
                        "paginaFinal" => "1485"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19966862"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dioscin ameliorates methotrexate-induced liver and kidney damages via adjusting miRNA-145-5p-mediated oxidative stress"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Li"
                            1 => "M&#46; Gao"
                            2 => "L&#46;H&#46; Yin"
                            3 => "L&#46;N&#46; Xu"
                            4 => "Y&#46; Qi"
                            5 => "P&#46; Sun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.freeradbiomed.2021.03.035"
                      "Revista" => array:6 [
                        "tituloSerie" => "Free Radic Biol Med&#46;"
                        "fecha" => "2021"
                        "volumen" => "169"
                        "paginaInicial" => "99"
                        "paginaFinal" => "109"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33836263"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-570 is a novel regulator of cellular senescence and inflammaging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;R&#46; Baker"
                            1 => "C&#46; Vuppusetty"
                            2 => "T&#46; Colley"
                            3 => "S&#46; Hassibi"
                            4 => "P&#46;S&#46; Fenwick"
                            5 => "L&#46;E&#46; Donnelly"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1096/fj.201800965R"
                      "Revista" => array:6 [
                        "tituloSerie" => "Faseb j&#46;"
                        "fecha" => "2019"
                        "volumen" => "33"
                        "paginaInicial" => "1605"
                        "paginaFinal" => "1616"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30156909"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-93-5p suppresses cellular senescence by directly targeting Bcl-w and p21"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;Y&#46; Choi"
                            1 => "H&#46;J&#46; Shin"
                            2 => "I&#46;H&#46; Bae"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.bbrc.2018.10.010"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Biophys Res Commun&#46;"
                        "fecha" => "2018"
                        "volumen" => "505"
                        "paginaInicial" => "1134"
                        "paginaFinal" => "1140"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30318121"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0155"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of microRNAs in endothelial cell pathophysiology"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Staszel"
                            1 => "B&#46; Zapa&#322;a"
                            2 => "A&#46; Polus"
                            3 => "A&#46; Sadakierska-Chudy"
                            4 => "B&#46; Kie&#263;-Wilk"
                            5 => "E&#46; St&#281;pie&#324;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Pol Arch Med Wewn&#46;"
                        "fecha" => "2011"
                        "volumen" => "121"
                        "paginaInicial" => "361"
                        "paginaFinal" => "366"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21946298"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0160"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of microRNAs in organismal and skin aging"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Gerasymchuk"
                            1 => "V&#46; Cherkasova"
                            2 => "O&#46; Kovalchuk"
                            3 => "I&#46; Kovalchuk"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3390/ijms21155281"
                      "Revista" => array:5 [
                        "tituloSerie" => "Int J Mol Sci&#46;"
                        "fecha" => "2020"
                        "volumen" => "21"
                        "paginaInicial" => "5281"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32722415"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0165"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Cellular senescence&#58; molecular mechanisms&#44; in vivo significance&#44; and redox considerations"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46; Muller"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/ars.2008.2104"
                      "Revista" => array:6 [
                        "tituloSerie" => "Antioxid Redox Signal&#46;"
                        "fecha" => "2009"
                        "volumen" => "11"
                        "paginaInicial" => "59"
                        "paginaFinal" => "98"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18976161"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0170"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Von Hippel-Lindau gene single nucleotide polymorphism &#40;rs1642742&#41; may be related to the occurrence and metastasis of HBV-related hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "X&#46; Chen"
                            1 => "H&#46; Zhang"
                            2 => "S&#46; Ou"
                            3 => "H&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Medicine &#40;Baltimore&#41;&#46;"
                        "fecha" => "2021"
                        "volumen" => "100"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0175"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Key genes associated with diabetes mellitus and hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G&#46;M&#46; Liu"
                            1 => "H&#46;D&#46; Zeng"
                            2 => "C&#46;Y&#46; Zhang"
                            3 => "J&#46;W&#46; Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Pathol Res Pract&#46;"
                        "fecha" => "2019"
                        "volumen" => "215"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0180"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Identification and localization of xylose-binding proteins as potential biomarkers for liver fibrosis&#47;cirrhosis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Zhong"
                            1 => "X&#46;X&#46; Sun"
                            2 => "P&#46; Zhang"
                            3 => "X&#46; Qin"
                            4 => "W&#46; Chen"
                            5 => "Y&#46; Guo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1039/c5mb00703h"
                      "Revista" => array:6 [
                        "tituloSerie" => "Mol Biosyst&#46;"
                        "fecha" => "2016"
                        "volumen" => "12"
                        "paginaInicial" => "598"
                        "paginaFinal" => "605"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26687723"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/03650596/0000009800000001/v2_202304080751/S0365059622002227/v2_202304080751/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "89516"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Article"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/03650596/0000009800000001/v2_202304080751/S0365059622002227/v2_202304080751/en/main.pdf?idApp=UINPBA00008Z&text.app=https://clinics.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0365059622002227?idApp=UINPBA00008Z"
]
Article information
ISSN: 03650596
Original language: English
The statistics are updated each day
Year/Month Html Pdf Total
2024 November 858 4 862
2024 October 164 100 264
2024 September 153 127 280
2024 August 190 166 356
2024 July 146 113 259
2024 June 135 83 218
2024 May 1150 83 1233
2024 April 1955 99 2054
2024 March 125 99 224
2024 February 135 89 224
2024 January 98 72 170
2023 December 99 65 164
2023 November 103 110 213
2023 October 61 80 141
2023 September 72 80 152
2023 August 57 31 88
2023 July 73 47 120
2023 June 53 64 117
2023 May 48 39 87
2023 April 39 39 78
2023 March 78 55 133
2023 February 74 60 134
2023 January 94 102 196
2022 December 92 50 142
2022 November 76 56 132
2022 October 31 49 80
Show all

Follow this link to access the full text of the article

Idiomas
Anais Brasileiros de Dermatologia
en pt
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.